?3168353 Summary - Canadian Patents Database (2025)

WO 2021/173829
PCT/US2021/019662
VACCINES AGAINST CORONAVIRUS AND METHODS OF USE
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS
[0002] The present application claims the benefit of U.S. Provisional Appl.
No. 62/981,451,
filed February 25, 2020; U.S. Provisional Appl. No. 63/004,380, filed April 2,
2020; U.S.
Provisional Appl. No. 63/028,404, filed May 21, 2020; U.S. Provisional Appl.
No.
63/033,349, filed June 2, 2020; U.S. Provisional Appl. No. 63/040,865, filed
June 18, 2020;
U.S. Provisional Appl. No. 63/046,415, filed June 30, 2020; U.S. Provisional
Appl. No.
63/062,762, filed August 7, 2020; U.S. Provisional Appl. No. 63/114,858, filed
November
17, 2020; U.S. Provisional Appl. No. 63/130,593 filed December 24, 2020; U.S.
Provisional
Appl. No. 63/136,973 Filed January 13, 2021; U.S. Provisional Appl. No.
62/981,168, filed
February 25, 2020; U.S. Provisional Appl. No. 63/022,032, filed May 8, 2020;
U.S.
Provisional Appl. No. 63/056,996, filed July 27, 2020; and U.S. Provisional
Appl. No.
63/063,157, filed August 7, 2020. The contents of each of these applications
are incorporated
herein by reference in the entirety.
[0003] SEQUENCE LISTING
[0004] This application includes a Sequence Listing submitted electronically
as a text file
named "104409 000596_SEtxt-, created on February 24, 2021 with a size of
58,410 bytes.
The Sequence Listing is incorporated by reference herein.
[0005] TECHNICAL FIELD
[0006] The present invention relates to a vaccine for Severe Acute Respiratory
Syndrome
coronavirus 2 (SARS-CoV-2) and methods of administering the vaccine.
[0007] BACKGROUND
[0008] COVID-19, known previously as 2019-nCoV pneumonia or disease, has
rapidly
emerged as a global threat to public health, joining severe acute respiratory
syndrome
(SARS) and Middle East respiratory syndrome (MERS) in a growing number of
coronavirus-
associated illnesses which have jumped from animals to people. There is an
imminent need
for medical countermeasures such as vaccines to combat the spread of such
emerging
coronaviruses. There are at least seven identified coronaviruses that infect
humans, including
MERS-CoV and SARS-CoV.
- 1 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0009] In December 2019, the city of Wuhan in China became the epicenter for a
global
outbreak of a novel coronavirus. This coronavirus, SARS-CoV-2, was isolated
and sequenced
from human airway epithelial cells from infected patients (Zhu, et al. A Novel
Coronavirus
from Patients with Pneumonia in China, 2019. N Engl J Med. 2020; Wu, et al. A
new
coronavirus associated with human respiratory disease in China Nature. 2020).
Disease
symptoms can range from mild flu-like to severe cases with life-threatening
pneumonia
(Huang, et al. Clinical features of patients infected with 2019 novel
coronavirus in Wuhan,
China. Lancet. 2020). The global situation is dynamically evolving, and on
January 30th,
2020 the World Health Organization declared COVID-19 as a public health
emergency of
international concern (PHEIC).
[0010] SUMMARY
100111 Provided herein are nucleic acid molecules encoding a SARS-CoV-2 spike
antigen.
According to some embodiments, the encoded SARS-CoV-2 spike antigen is a
consensus
antigen. In some embodiments, the nucleic acid molecule comprises: a nucleic
acid sequence
having at least about 90% identity over an entire length of the nucleic acid
sequence set forth
in nucleotides 55 to 3837 of SEQ ID NO: 2; a nucleic acid sequence having at
least about
90% identity over an entire length of SEQ ID NO: 2; the nucleic acid sequence
of nucleotides
55 to 3837 of SEQ ID NO: 2; the nucleic acid sequence of SEQ ID NO: 2; a
nucleic acid
sequence having at least about 90% identity over an entire length of SEQ ID
NO: 3: the
nucleic acid sequence of SEQ ID NO: 3; a nucleic acid sequence having at least
about 90%
identity over an entire length of nucleotides 55 to 3837 of SEQ ID NO: 5; a
nucleic acid
sequence having at least about 90% identity over an entire length of SEQ ID
NO: 5; the
nucleic acid sequence of nucleotides 55 to 3837 of SEQ ID NO: 5; the nucleic
acid sequence
of SEQ ID NO: 5; a nucleic acid sequence having at least about 90% identity
over an entire
length of SEQ ID NO: 6; or the nucleic acid sequence of SEQ ID NO: 6. Also
provided
herein are nucleic acid molecules encoding a SARS-CoV-2 spike antigen, wherein
the SARS-
CoV-2 spike antigen comprises: an amino acid sequence having at least about
90% identity
over an entire length of residues 19 to 1279 of SEQ ID NO: 1; the amino acid
sequence set
forth in residues 19 to 1279 of SEQ ID NO: 1; an amino acid sequence having at
least about
90% identity over an entire length of SEQ ID NO: 1; the amino acid sequence of
SEQ ID
NO: 1; an amino acid sequence having at least about 90% identity over an
entire length of
residues 19 to 1279 of SEQ ID NO: 4; an amino acid sequence having at least
about 90%
- 2 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
identity over an entire length of SEQ ID NO: 4; the amino acid sequence set
forth in residues
19 to 1279 of SEQ ID NO: 4, or the amino acid sequence of SEQ ID NO: 4.
[0012] In some embodiments, the nucleic acid molecule encoding the SARS-CoV-2
antigen
is incorporated into a viral particle.
[0013] Further provided are vectors comprising the nucleic acid molecule
encoding the
SARS-CoV-2 antigen. In some embodiments, the vector is an expression vector.
The nucleic
acid molecule may be operably linked to a regulatory element selected from a
promoter and a
poly-adenylation signal. The expression vector may be a plasmid or viral
vector.
[0014] Immunogenic compositions comprising an effective amount of the vector
or viral
particle are disclosed. The immunogenic composition may comprise a
pharmaceutically
acceptable excipient, such as but not limited to, a buffer. The buffer may
optionally be saline-
sodium citrate buffer. In some embodiments, the immunogenic compositions
comprise an
adjuvant.
[0015] Also provided herein are SARS-CoV-2 spike antigens. According to some
embodiments, the SARS-CoV-2 spike antigen is a consensus antigen. In some
embodiments,
the SARS-CoV-2 spike antigen comprises: an amino acid sequence having at least
about 90%
identity over an entire length of residues 19 to 1279 of SEQ ID NO: 1; the
amino acid
sequence set forth in residues 19 to 1279 of SEQ ID NO: 1; an amino acid
sequence having at
least about 90% identity over an entire length of SEQ ID NO: 1; the amino acid
sequence of
SEQ ID NO: 1; an amino acid sequence having at least about 90% identity over
an entire
length of residues 19 to 1279 of SEQ ID NO: 4; an amino acid sequence having
at least about
90% identity over an entire length of SEQ ID NO: 4; the amino acid sequence
set forth in
residues 19 to 1279 of SEQ ID NO: 4; or the amino acid sequence of SEQ ID NO:
4.
[0016] Further provided herein are vaccines for the prevention or treatment of
Severe Acute
Respiratory Syndrome coronavirus 2 (SARS-CoV-2) infection. The vaccines
comprising an
effective amount of any one or combination of the aforementioned nucleic acid
molecules,
vectors, or antigens. According to some embodiments, the vaccine further
comprises a
pharmaceutically acceptable excipient. The pharmaceutically acceptable
excipient may be a
buffer, optionally saline-sodium citrate buffer. According to some
embodiments, the vaccine
further comprises an adjuvant.
100171 Methods of inducing an immune response against Severe Acute Respiratory
Syndrome coronavirus 2 (SARS-CoV-2) in a subject in need thereof are further
provided. In
come embodiments, the methods of inducing an immune response comprise
administering an
effective amount of any one or combination of the aforementioned nucleic acid
molecules,
- 3 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
vectors, immunogenic compositions, antigens, or vaccines to the subject. Also
provided
herein are methods of protecting a subject in need thereof from infection with
SARS-CoV-2,
the method comprising administering an effective amount of any one or
combination of the
aforementioned nucleic acid molecules, vectors, immunogenic compositions,
antigens, or
vaccines to the subject. Further provided are methods of treating SARS-CoV-2
infection in a
subject in need thereof, the method comprising administering an effective
amount of any one
or combination of the aforementioned nucleic acid molecules, vectors,
immunogenic
compositions, antigens, or vaccines to the subject. In any of these methods,
the administering
may include at least one of electroporation and injection. According to some
embodiments,
the administering comprises parenteral administration, for example by
intradermal,
intramuscular, or subcutaneous injection, optionally followed by
electroporation. In some
embodiments of the disclosed methods, an initial dose of about 0.5 mg to about
2.0 mg of the
nucleic acid molecule is administered to the subject, optionally the initial
dose is 0.5 mg, 1.0
mg or 2.0 mg of the nucleic acid molecule. The methods may further involve
administration
of a subsequent dose of about 0.5 mg to about 2.0 mg of the nucleic acid
molecule to the
subject about four weeks after the initial dose, optionally wherein the
subsequent dose is 0.5
mg,1.0 mg or 2.0 mg of the nucleic acid molecule. In still further
embodiments, the methods
involve administration of one or more further subsequent doses of about 0.5 mg
to about 2.0
mg of the nucleic acid molecule to the subject at least twelve weeks after the
initial dose,
optionally wherein the further subsequent dose is 0.5 mg, 1.0 mg. or 2.0 mg of
the nucleic
acid molecule. In any of these embodiments, INO-4800 or a biosimilar thereof
is
administered.
[0018] Also provided herein are uses of any one or combination of the
disclosed nucleic
acid molecules, vectors, immunogenic compositions, antigens, or vaccines in a
method of
inducing an immune response against Severe Acute Respiratory Syndrome
coronavirus 2
(SARS-CoV-2) in a subject in need thereof Further provided are uses of any one
or
combination of the disclosed nucleic acid molecules, vectors, immunogenic
compositions,
antigens, or vaccines in a method of protecting a subject from infection with
Severe Acute
Respiratory Syndrome coronavirus 2 (SARS-CoV-2). Also provided herein are uses
of any
one or combination of the disclosed nucleic acid molecules, vectors,
immunogenic
compositions, antigens, or vaccines in a method of treating a subject in need
thereof against
SARS-CoV-2 infection. In accordance with any of these uses, the nucleic acid
molecule, the
vector, the immunogenic composition, the antigen, or the vaccine may be
administered to the
subject by at least one of electroporation and injection. In some embodiments,
the nucleic
- 4 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
acid molecule, the vector, the immunogenic composition, the antigen, or the
vaccine is
administered parenterally to the subject followed by electroporation. In some
embodiments
of the disclosed uses, an initial dose of about 0.5 mg to about 2.0 mg of the
nucleic acid
molecule is administered to the subject, optionally the initial dose is 0.5
mg, 1.0 mg or 2.0 mg
of the nucleic acid molecule. The uses may further involve administration of a
subsequent
dose of about 0.5 mg to about 2.0 mg of the nucleic acid molecule to the
subject about four
weeks after the initial dose, optionally wherein the subsequent dose is 0.5
mg,1.0 mg or 2.0
mg of the nucleic acid molecule. In still further embodiments, the uses
involve administration
of one or more further subsequent doses of about 0.5 mg to about 2.0 mg of the
nucleic acid
molecule to the subject at least twelve weeks after the initial dose,
optionally wherein the
further subsequent dose is 0.5 mg, 1.0 mg, or 2.0 mg of the nucleic acid
molecule. In any of
these embodiments, INO-4800 or a biosimilar thereof is administered.
100191 Further provided herein are uses of any one or combination of the
disclosed nucleic
acid molecules, vectors, immunogenic compositions, antigens, or vaccines in
the preparation
of a medicament. In some embodiments, the medicament is for treating or
protecting against
infection with Severe Acute Respiratory Syndrome coronavirus 2 (SARS-CoV-2).
In some
embodiments, the medicament is for treating or protecting against a disease or
disorder
associated with SARS-CoV-2 infection. In some embodiments, the medicament is
for treating
or protecting against Coronavirus Disease 2019 (COVID-19), Multisystem
inflammatory
syndrome in adults (MIS-A), or Multisystem inflammatory syndrome in children
(MIS-C).
[0020] The invention further relates to a method of detecting a persistent
cellular immune
response in a subject, the method comprising the steps of: administering an
immunogenic
composition for inducing an immune response against a SARS-CoV-2 antigen to a
subject in
need thereof; isolating peripheral mononuclear cells (PBMCs) from the subject;
stimulating
the isolated PBMCs with a spike antigen comprising an amino acid sequence
selected from
the group consisting of: the amino acid sequence set forth in residues 19 to
1279 of SEQ ID
NO: lthe amino acid sequence of SEQ ID NO: 1; the amino acid sequence set
forth in
residues 19 to 1279 of SEQ ID NO: 4; or the amino acid sequence of SEQ ID NO:
4; or a
fragment thereof comprising at least 20 amino acids; and detecting at least
one of the number
of cytokine expressing cells and the level of cytokine expression. In one
embodiment, the
step of detecting at least one of the number of cytokine expressing cells and
the level of
cytokine expression is performed using Enzyme-linked immunospot (ELISpot) or
Intracellular Cytokine Staining (ICS) analysis using flow cytometry.
- 5 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0021] In one embodiment, the subject is administered an immunogenic
composition
comprising a nucleic acid molecule, wherein the nucleic acid molecule
comprises a
nucleotide sequence encoding a peptide comprising: an amino acid sequence
having at least
about 90% identity over an entire length of residues 19 to 1279 of SEQ ID NO:
1; the amino
acid sequence set forth in residues 19 to 1279 of SEQ ID NO: 1; an amino acid
sequence
having at least about 90% identity over an entire length of SEQ ID NO: 1; the
amino acid
sequence of SEQ ID NO: 1; an amino acid sequence having at least about 90%
identity over
an entire length of residues 19 to 1279 of SEQ ID NO: 4; an amino acid
sequence having at
least about 90% identity over an entire length of SEQ ID NO: 4; the amino acid
sequence set
forth in residues 19 to 1279 of SEQ ID NO: 4; or the amino acid sequence of
SEQ ID NO: 4.
[0022] BRIEF DESCRIPTION OF THE DRAWINGS
100231 Figures 1A, 1B, 1C, and 1D illustrate the design and expression of SARS-
CoV-2
synthetic DNA vaccine constructs. Figure 1A shows a schematic diagram of SARS-
CoV-2
synthetic DNA vaccine constructs, pGX9501 (matched) and pGX9503 (outlier (OL))
containing the IgE leader sequence and SARS-CoV-2 spike protein insert (-Covid-
19 spike
antigen" or "Covid-19 spike-OL antigen"). Figure 1B shows results of an RT-PCR
assay of
RNA extract from COS-7 cells transfected in duplicate with pGX9501 or pGX9503.
Extracted RNA was analyzed by RT-PCR using PCR assays designed for each target
and for
COS-713-Actin mRNA, used as an internal expression normalization gene. Delta
CT (A Cr)
was calculated as the CT of the target minus the CT of f3-Actin for each
transfection
concentration and is plotted against the log of the mass of pDNA transfected
(Plotted as
mean SD). Figure 1C shows analysis of in vitro expression of Spike protein
after
transfection of 293T cells with pGX9501, pGX9503 or MOCK plasmid by Western
blot.
293T cell lysates were resolved on a gel and probed with a polyclonal anti-
SARS Spike
Protein. Blots were stripped then probed with an anti-13-actin loading
control. Figure 1D
shows in vitro immunofluorescent staining of 293T cells transfected with
3pg/well of
pGX9501, pGX9503 or pVax (empty control vector). Expression of Spike protein
was
measured with polyclonal anti-SARS Spike Protein IgG and anti-IgG secondary.
Cell nuclei
were counterstained with DAPI. Images were captured using ImageXpressTM Pico
automated
cell imaging system.
[0024] Figure 2 illustrates an IgG binding screen of a panel of SARS-CoV-2 and
SARS-
CoV antigens using sera from INO-4800-treated mice. BALB/c mice were immunized
on
Day 0 with 25 jig INO-4800 or pVAX-empty vector (Control) as described in the
methods.
- 6 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
Protein antigen binding of IgG at 1:50 and 1:250 serum dilutions from mice at
day 14. Data
shown represent mean 0D450 nm values (mean+SD) for each group of 4 mice.
[0025] Figures 3A, 3B, 3C, and 3D demonstrate humoral responses to SARS-CoV-2
S
1+2 and S receptor binding domain (RBD) protein antigen in BALB/c mice after a
single
dose of INO-4800. BALB/c mice were immunized on Day 0 with indicated doses of
INO-
4800 or pVAX-empty vector as described in Example 1. SARS-CoV-2 S1+2 (Figure
3A) or
SARS-CoV-2 RBD (Figure 3B) protein antigen binding of IgG in serial serum
dilutions from
mice at day 14 are shown. Data shown represent mean 0D450 nm values (mean+SD)
for
each group of 8 mice (Figure 3A and 3B) and 5 mice (Figure 3C and 3D). Serum
IgG
binding endpoint titers to SARS-CoV-2 S1+2 (Figure 3B) and SARS-CoV-2 RBD
(Figure
3D) protein. Data representative of 2 independent experiments.
[0026] Figures 4A and 4B illustrate neutralizing antibody responses after
immunization
with INO-4800. BALB/c mice (n of 5 per group) were immunized twice on days 0
and 14
with 10 mg of INO-4800. Sera was collected on day 7 post-2nd immunization and
serial
dilutions were incubated with a pseudovirus displaying the SARS-CoV-2 Spike
and co-
incubated with ACE2-293T cells. Figure 4A shows neutralization 1D50 (mean+SD)
in
naive and INO-4800 immunized mice. Figure 4B shows relative luminescence units
(RLU)
for sera from naive mice and mice vaccinated with INO-4800 as described in
methods.
[0027] Figures SA and SB show humoral responses to SARS-CoV-2 in Hartley
guinea
pigs after a single dose of INO-4800. Hartley guinea pigs mice were immunized
on Day 0
with 100 jug INO-4800 or pVAX-empty vector as described in Example 1. Figure
5A shows
SARS-CoV-2 S protein antigen binding of IgG in serial serum dilutions at day 0
and 14. Data
shown represent mean 0D450 nm values (mean+SD) for the 5 guinea pigs. Figure
5B shows
serum IgG binding titers (mean SD) to SARS-CoV-2 S protein at day 14. P values
determined by Mann-Whitney test.
100281 Figures 6A-6F demonstrate that INO-4800 immunized mouse and guinea pig
sera
compete with ACE2 receptor for SARS-CoV-2 Spike protein binding. Figure 6A
illustrates
that soluble ACE2 receptor binds to CoV-2 full-length spike with an EC50 of
0.025 pg/ml.
Figure 6B illustrates that purified serum IgG from BALB/c mice (n of 5 per
group) after
second immunization with INO-4800 yields significant competition against ACE2
receptor.
Serum IgG samples from the animals were run in triplicate. Figure 6C
illustrates that IgGs
purified from n=5 mice day 7 post second immunization with INO-4800 show
significant
competition against ACE2 receptor binding to SARS-CoV-2 S 1+2 protein. The
soluble
ACE2 concentration for the competition assay is ¨0.1 ug/ml. Bars represent the
mean and
- 7 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
standard deviation of AUC. Figure 6D illustrates Hartley guinea pigs immunized
on Day 0
and 14 with 100 pg INO-4800 or pVAX-empty vector as described in the methods.
Day 28
collected sera (diluted 1:20) was added to SARS-CoV-2 coated wells prior to
the addition of
serial dilutions of ACE2 protein. Detection of ACE2 binding to SARS-CoV-2 S
protein was
measured. Sera collected from 5 INO-4800-treated and 3 pVAX-treated animals
were used in
this experiment. Figure 6E illustrates serial dilutions of guinea pig sera
collected on day 21
were added to SARS-CoV-2 coated wells prior to the addition of ACE2 protein.
Detection of
ACE2 binding to SARS-CoV-2 S protein was measured. Sera collected from 4 INO-
4800-
treated and 5 pVAX-treated guinea pigs were used in this experiment. Figure 6F
depicts
IgGs purified from n=5 mice day 14 post second immunization with INO-4800 show
competition against ACE2 receptor binding to SARS-CoV-2 Spike protein compared
to
pooled naïve mice IgGs. Naïve mice were run in a single column. Vaccinated
mice were run
in duplicate. If error bars are not visible, error is smaller than the data
point.
[0029] Figures 7A-7D illustrate detection of SARS-CoV-2 S protein-reactive
antibodies in
the BAL of INO-4800 immunized animals. BALB/c mice (n of 5 per group) were
immunized
on days 0 and 14 with INO-4800 or pVAX and BAL collected at day 21 (Figures 7A
and
7B). Hartley guinea pigs (n of 5 per group) were immunized on days 0, 14 and
21 with 'NO-
4800 or pVAX and BAL collected at day 42 (Figures 7C and 7D). Bronchoalveolar
lavage
fluid was assayed in duplicate for SARS-CoV-2 Spike protein-specific IgG
antibodies by
ELISA. Data are presented as endpoint titers (Figures 7A and 7C), and BAL
dilution curves
with raw OD 450 nm values (Figures 7B and 7D). In Figures 7A and 7C, bars
represent the
average of each group and error bars the standard deviation. "p<0.01 by Mann-
Whitney U
test.
[0030] Figure 8A-8C show induction of T cell responses in BALB/c mice post-
administration of INO-4800. BALB/c mice (n=5/group) were immunized with 2.5 or
10 mg
INO-4800. T cell responses were analyzed in the animals on days 4, 7, 10
(Figures 8A and
8B), and day 14 (Figure 8C). T cell responses were measured by IFN-y ELISpot
in
splenocytes stimulated for 20 hours with overlapping peptide pools spanning
the SARS-CoV-
2 (Figure 8A), SARS-CoV (Figure 8B), or MERS-CoV (Figure 8C) Spike proteins.
Bars
represent the mean +SD.
100311 Figures 9 and 10 illustrate cellular and humoral immune responses
measured in
INO-4800-treated New Zealand White (NZW) rabbits. Day 0 and 28 intradermal
delivery of
pDNA. PBMC IFN-y ELISpot (Figure 9); Serum IgG binding ELISA (Figure 10).
- 8 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0032] Figures 11A-11E illustrate humoral immune responses to SARS-CoV-2 spike
protein measured in INO-4800 treated in rhesus monkeys. Day 0 and 28
intradermal delivery
of pDNA. Serum IgG binding ELISA.
[0033] Figures 12A-12G illustrate humoral immune responses to SARS and MERS
spike
protein measured in INO-4800 treated rhesus monkeys. Day 0 and 28 intradermal
delivery of
pDNA. Serum IgG binding ELISA. (Figure 12A-12G; left panel, 1 mg INO-4800;
right
panel, 2 mg INO-4800).
[0034] Figures 13A-13C illustrate cellular immune responses measured by PBMC
IFN-y
ELISpot in INO-4800-treated in rhesus monkeys following intradermal delivery
of pDNA on
days 0 and 28 intradermal. Results are shown in Figure 13A (SARS CoV-2 Spike
peptides);
13B (SARS CoV Spike peptides); and 13C (MERS CoV Spike peptides).
[0035] Figures 14A and 14B show T cell epitope mapping after INO-4800
administration
to BALB/c mice. Splenocytes were stimulated for 20 hours with SARS-CoV-2
peptide matrix
mapping pools. Figure 14A demonstrates T cell responses following stimulation
with matrix
mapping SARS-CoV-2 peptide pools. Bars represent the mean +SD of 5 mice.
Figure 14B
shows the map of the SARS-CoV-2 Spike protein and identification of
immunodominant
peptides in BALB/c mice. A known immunodominant SARS-CoV HLA-A2 epitope is
included for comparison. Figure 14B discloses SEQ ID NOS 26-35, respectively,
in order of
appearance.
[0036] Figures 15A-15H depict humoral correlates of protection in throat and
nasal
compartments. (Figures 15A-15D) Correlation of throat viral load Log10 cDNA
copies mL-1
at day 1 (Figures 15A, 15B) and day 3 (Figures 15C, 15D) post SARS-CoV-2
challenge
with microneutralization titers (Figs. 15A, 15C) and RBD IgG binding endpoint
titers (Figs.
15B, 15D). (Figs. 15E-15H) Same analysis for nasal viral loads. P and R values
provided for
two-sided non-parametric Spearman rank-correlation analyses. Control animals ¨
red filled
circles, INO-4800 X1 ¨ green filled circles and INO-4800 X2 ¨ blue filled
circles.
[0037] Figure 16 illustrates the Phase I study flow diagram.
[0038] Figures 17A, 17B, 17C, and 17D illustrate the humoral antibody response
of the
phase I clinical study. The humoral response in the 1.0 mg dose group and 2.0
mg dose group
was assessed for the ability to neutralize of live virus (n=18, 1.0mg; n=19,
2.0 mg) (Figure
17A); binding to the RBD regions (Figure 17B); and binding to whole spike
protein (Si and
S2) (Figure 17C). End point titers were calculated as the titer that exhibited
an OD 3.0 SD
above baseline, titers at baseline were set at 1. In Figure 17D, the humoral
response in the
1.0 mg dose group and 2.0 mg dose group was assessed for the ability to bind
whole spike
- 9 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
protein (Si and S2) (n=19, 1.0mg; n=19, 2.0 mg). End point titers were
calculated as the titer
that exhibited an OD 3.0 SD above baseline, titers at baseline were set at 1.
A response to
live virus neutralization was a PRNT IC50 > 10. In all graphs horizontal lines
represent the
Median and bars represent the Interquartile Range.
[0039] Figures 18A-18G illustrate Phase I clinical study cellular immune
response
analytical results. PBMCs isolated from vaccinated individuals were stimulated
in vitro with
SARS-CoV-2 spike antigen. The number of cells capable of secreting IFN-gamma
were
measured in a standard ELISpot assay for the 1.0 mg dose group and 2.0 mg dose
group
(Figure 18A). Horizontal lines represent Medians and bars represent
Interquartile Ranges.
As shown in Figure 18B, peptides spanning the entirety of the spike antigen
were divided
into pools and tested individually in ELISpot, with pools mapped to specific
regions of the
antigen. Three subjects are shown exemplifying the diversity of pool responses
and
associated magnitude across subjects. The pie chart represents the diversity
of entirety of the
2.0mg dose group. As illustrated in Figure 18C, SARS-CoV-2 spike specific
cytokine
production was measured from CD4+ and CD8+ T cells via flow cytometry. Bars
represent
Mean response. Cytokine production is additionally broken out in Figure 18D
using CCR7
and CD45RA into Central Memory (CM), Effector Memory (EM) or Effector (E)
differentiation status with data conveying what percentage of the overall
cytokine response
originates from what differentiated group. Pie charts represent the
polyfunctionality of CD4+
and CD8+ T cells for each dose cohort are provided in Figure 18E. IL-4
production by CD4+
T cells for each dose cohort is illustrated in Figure 18F. Horizontal lines
represent Mean
response. Graphs represent all evaluable subjects. Statistical analyses were
performed on all
paired datasets. Those that were significant are noted within the figure, lack
of notation in
the figure represents lack of statistical significance. Figure 18G provides a
heat map of each
subject in the 2.0mg dose group and the percentage of their ELISpot response
dedicated to
each pool covering the SARS-CoV-2 spike antigen.
[0040] Figure 19 illustrates the Phase I Related Systemic and Local Adverse
Events in
severity of mild (Grade 1), moderate (Grade 2), severe (Grade 3) and life-
threatening (Grade
4).
100411 Figure 20 provides supplementary data for humoral immune response.
Three
convalescent samples (all 3 with symptoms but non-hospitalized), tested by the
ELISpot
assay showed lower T cell responses, with a median of 33, than the 2.0 mg dose
group at
Week 8.
[0042] Figure 21 provides supplementary Enzyme-linked immunospot (ELISpot)
data.
- 10 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0043] Figures 22A-22F depict humoral and cellular responses in rhesus
macaques
vaccinated with INO-4800. Study outline (Fig. 22A). Spike-specific IgG (Fig.
22B), RBD
(Fig. 22C) and live virus-neutralising antibodies (Fig. 22D) measured in serum
from rhesus
macaques that received 1 or 2 doses of INO-4800 or were unvaccinated
(Control). Lines
represent the geometric means. Cellular immune responses in rhesus macaques
vaccinated
with INO-4800. SARS-CoV-2 Spike-specific interferon gamma (IFNy) secretion
from
PBMCs was measured in rhesus macaques that received 1 or 2 doses of INO-4800
or were
unvaccinated (Control) pre- (Fig. 22E) and post-challenge (Fig. 22F). PBMCs
were
stimulated with 5 separate peptide pools spanning the spike protein and SFU
frequencies
measured in response to each pool summed. Lines represent the means.
[0044] Figures 23A-23C illustrate change in weight, temperature and hemoglobin
in the
animals through the duration of the study. Animals received one (INO-4800X1)
or two (INO-
4800X2) doses of INO-4800 or were unvaccinated (control). Percentage change in
body
weights (Fig. 23A), temperature (Fig. 23B) and hemoglobin counts (Fig. 23C) of
individual
animals were recorded and plotted at the indicated time points pre- and post-
challenge. Lines
represent mean (Fig. 23A) and geometric mean (Fig. 23B & Fig. 23C) value for
each group.
[0045] Figures 24A-24F illustrate the upper respiratory tract viral loads
detected by RT-
qPCR following challenge with SARS-CoV-2. Animals received one (INO-4800X1) or
two
(INO-4800X2) doses of INO-4800 or were unvaccinated (control). Viral load
plotted as
Log10 cDNA copies/ml for each animal in throat swabs (Figs. 24A-24C) and nasal
swabs
(Figs. 24D-24F). (Figs. 24A&24D) Lines represent group geometric means with
95% CI.
Area under the curve (AUC) of viral loads for throat swabs (Fig. 24B) and
nasal swabs (Fig.
24E) for each experimental group. Peak viral loads measured in each animal
during the
challenge period for throat swabs (Fig. 24C) and nasal swabs (Fig. 24F). LLOQ
(lower limit
of quantification, 3.80 log copies/m1) and LLOD (lower limit of detection,
3.47 log
copies/m1). Positive samples detected below the LLOQ were assigned the value
of 3.80 log
copies/ml. * p < 0.05 with Mann-Whitney t test.
[0046] Figures 25A-25F illustrate the upper respiratory tract subgenomic viral
loads
detected by RT-qPCR following challenge with SARS-CoV-2. Animals received one
(1NO-
4800X1) or two (INO-4800X2) doses of INO-4800 or were unvaccinated (control).
Viral
load plotted as Log10 cDNA copies/ml for each animal in throat swabs (Figs.
25A-25C) and
nasal swabs (Figs. 25D-25F). (Figs. 25A and 25D) Lines represent group
geometric means
with 95% CI. Area under the curve (AUC) of viral loads for throat swabs (Fig.
25B) and
nasal swabs (Fig. 25E) for each experimental group. Peak viral loads measured
in each
- 11 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
animal during the challenge period for throat swabs (Fig. 25C) and nasal swabs
(Fig. 25F).
LLOQ (4.11 log copies/mL) and LLOD (3.06 log copies/mL). Positive samples
detected
below the LLOQ were assigned the value of 3.81 log copies/ml.
[0047] Figures 26A-26D illustrate lower respiratory tract viral loads detected
by RT-qPCR
following challenge with SARS-CoV-2. Animals received one (INO-4800X1) or two
(INO-
4800X1) doses of INO-4800 or were unvaccinated (control). SARS-CoV-2 genomic
and
subgenomic viral loads were measured for individual animals in bronchoalveolar
lavage
(BAL (Figs. 26A and 26B)) and lung tissue (Figs. 26C and 260) samples
collected at
necropsy (6-8 days post challenge). Bars represent group medians. Assay LLOQ's
and
LLOD' s are provided in the methods section.
[0048] Figure 27 illustrates viral RNA in animal tissue post challenge.
Animals received
one (INO-4800X1) or two (INO-4800X2) doses of INO-4800 or were unvaccinated
(control).
SARS-CoV-2 viral loads were measured for individual animals in tissue samples
collected at
necropsy (6-8 DPC). Bars represent group median with 95% Cl. Positive tissue
samples
detected below the limit of quantification (LoQ) of 4.76 log copies/ml were
assigned the
value of 5 copies/ill, this equates to 4.46 log copies/g, whilst undetected
samples were
assigned the value of < 2.3 copies/ill, equivalent to the assay's lower limit
of detection (LoD)
which equates to 4.76 log copies/g.
[0049] Figure 28 shows representative histopathology (H&E stain) and presence
of SARS-
CoV-2 viral RNA (ISH RNAScope stain) in animals vaccinated with 1 dose (top),
2 doses
(middle) or unvaccinated (bottom). Animals vaccinated with 1 dose showed
multifocal
minimal to mild alveolar and interstitial pneumonia (*), with higher severity
in animal 10A.
The remaining animals from group 1 show minimal/mild inflammatory infiltrates
(*). Mild
perivascular cuffing was also observed (arrowheads) and viral RNA was shown by
ISH
within the lesions (arrows), abundantly in animal 10A, and in small amounts in
animals 30A,
24A, 21A and 38A (arrows). Animals vaccinated with 2 doses showed multifocal
minimal to
mild alveolar and interstitial pneumonia (*) together with minimal
perivascular cuffing
(arrowheads). Small quantities of viral RNA were observed by ISH within the
lesions from
animals 9A, 45A, 33A and 13A (arrows). Unvaccinated animals showed moderate
multifocal
alveolar and interstitial pneumonia (*), with presence of abundant viral RNA
within the
lesions from all animals (arrows).
[0050] Figures 29A-29G illustrate lung disease burden measured by
histopathology and
CT scan following challenge with SARS-CoV-2. Total histopathology score (Fig.
29A), and
image analysis of area positively stained area in ISH RNAScope labelled
sections for viral
- 12 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
RNA (Fig. 29B). Fig. 29C provides a heat map illustration of histopathology
scoring for each
parameter for individual animals. Total CT score (Fig. 29E). CT radiology
scores for
individual animals (Figs. 29D-29G). Fig. 29D: The extent of abnormality as a
percentage of
the lung affected. (Fig. 29E: COVID disease pattern with scoring based on
presence of
nodules, ground glass opacity, and consolidation. Fig. 29F: Zone
classification (lung is
divided into 12 zones and each zone showing abnormalities is attributed 1
point). Fig. 29G:
Total cumulative CT score (Pattern + Zone scores). Line on graphs represent
median value
of group. * p < 0.05 with Mann-Whitney t test.
[0051] Figure 30 illustrates representative example of pulmonary abnormalities
identified
on images constructed from CT scans. Images represent animals that did not
receive a
vaccination (control): 8A [A], 25A FBI, 28A [C], 14A [D], 50A [E]; animals
that received a
single dose of INO-4800 vaccine: 10A [F], 21A [G], 38A [H]; animals that
received two
doses of INO-4800 vaccine: 21A [I], 33A [J]. Arrows indicate areas of ground
glass
opacification and areas of consolidation. Images from macaques that did not
have abnormal
features are not shown.
[0052] Figures 31A through Figure 31F depict ELISpot images of IFN-y+ mouse
splenocytes after stimulation with SARS-CoV-2 and SARS antigens. Mice were
immunized
on day 0 and splenocytes harvested at the indicated time points. IFNy-
secreting cells in the
spleens of immunized animals were enumerated via ELISpot assay. Representative
images
show SARS-CoV-2 specific (Figure 31A through Figure 31C) and SARS-CoV-specific
(Figure 31D through Figure 31F) IFNy spot forming units in the splenocyte
population at
days 4, 7, and 10 post-immunization. Images were captured by ImmunoSpot CTL
reader.
[0053] Figure 32A and Figure 32B depict flow cytometric analysis of T cell
populations
producing IFN-y upon SARS-CoV-2 S protein stimulation. Splenocytes harvested
from
BALB/c and C57BL/6 mice 14 days after pVAX or INO-4800 treatment were made
into
single cell suspensions. The cells were stimulated for 6 hours with SARS-CoV-2
overlapping
peptide pools. Figure 32A: CD4+ and CD8+ T cell gating strategy; singlets were
gated on
(i), then lymphocytes (ii) followed by live CD45+ cells (iii). Next CD3+ cells
were gated
(iv) and from that population CD4+ (v) and CD8+ (vi) T-cells were gated. IFNy+
cells were
gated from each of the CD4+ (vii) and CD8+ (viii) T-cell populations. Figure
32B: The
percentage of CD4+ and CD8+ T cells producing IFNy is depicted. Bars represent
mean
+SD. 4 BALB/c and 4 C57BL/6 mice were used in this study. * p < 0.05, Mann
Whitney test.
[0054] Figures 33A through 33H depict humoral and cellular immune responses in
rhesus
macaques. Figure 33A: The study outline showing the vaccination regimen and
blood
- 13 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
collection timepoints. Figure 33B: Schematic of SARS-CoV-2 spike protein.
Figure 33C:
SARS-CoV-2 Sl+S2 ECD, 51, RBD and S2 protein antigen binding of IgG in
serially diluted
NHP sera collected on Week 0, 2, 6, 12 and 15. Data represents the mean
endpoint titers for
each individual NHP. (D&E) Pseudoneutralization assay using NHP sera, showing
the
presence of SARS-CoV-2 specific neutralizing antibodies against the D614
(Figure 33D) and
G614 (Figure 33E) variants of SARS-CoV-2. Figure 33F and Figure 33G: Serum
collected
at Week 6 from INO-4800 vaccinated NHPs inhibited ACE2 binding. Figure 33F:
Plate-
based ACE2 competition assay. Figure 33G: Flow-based ACE2 inhibition assay
showing
that inhibition of ACE2 binding in serially diluted NHP sera. Figure 33H: T
cell responses
were measured by 11:N-7 ELISpot in PBMCs harvested at weeks 0, 2, 6 and 15,
and
stimulated for 20h with overlapping peptide pools spanning the SARS-CoV-2
Spike protein.
Bars represent the mean H- SD,
100551 Figure 34 depicts serum IgG cross-reactivity to SARS-CoV and MERS-CoV
spike
protein. IgG binding was measured in sera from IN 0-4800 vaccinated rhesus
macaques to
SARS-CoV Si and MERS-CoV Si protein antigen.
[0056] Figure 35 depicts bronchoalveolar lavage (BAL) IgG reactive to SARS-CoV-
2 S
protein antigens. BAL samples collected from vaccinated animals were assessed
for SARS-
CoV-2 reactive IgG binding to the full length SARS-CoV-2 spike protein and the
RBD
domain.
[0057] Figure 36A and Figure 36B depict exemplary experimental data
demonstrating
cellular response cross-reactivity to SARS-CoV and MERS-CoV spike protein.
PBMC
responses were analyzed by IFNy ELISpot after stimulation with overlapping
peptide pools
spanning the SARS-CoV-1 spike protein (Figure 36A) and MERS-CoV spike protein
(Figure 36B). Bars represent the mean + SD.
[0058] Figure 37A through Figure 37C depict exemplary experiments
demonstrating
recall of humoral immune responses after viral challenge. Figure 37A: Study
outline. Figure
37B: IgG binding ELISA. SARS-CoV-2 S1+S2 and SARS-CoV-2 RBD protein antigen
binding of IgG in diluted NHP sera collected prior to challenge, during
challenge and post
challenge. Figure 37C: Pseudo-neutralization assay using NHP sera, showing the
presence of
SARS-CoV-2 specific neutralizing antibodies against the D614 and G614 variants
of SARS-
CoV-2 before and after viral challenge in IN0-4800 vaccinated (top panels) and
naïve
animals (bottom panels).
[0059] Figure 38 depicts exemplary experiments demonstrating recall of
cellular immune
responses after viral challenge. T cells responses were analyzed by IFNy
ELISpot in PBMCs
- 14 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
stimulated with overlapping peptide pools spanning the SARS-CoV-2 spike
protein. Bars
represent the mean + SD. T cell responses analyzed by IFNy ELISpot in PBMCs
isolated pre
and post challenge with SARS-CoV-2 virus. Left panel naive animals, right
panel INO-4800
vaccinated animals.
[0060] Figure 39 depicts exemplary experiments demonstrating recall of
cellular immune
responses after viral challenge in individual rhesus macaques. Cellular
responses were
analyzed pre and post viral challenge by IFNy ELISpot in PBMCs stimulated with
overlapping peptide pools spanning the SARS-CoV-2 spike protein. Right panel
naive
animals, left panel INO-4800 vaccinated animals.
[0061] Figures 40A through 40F depict viral loads in the BAL fluid and Nasal
swabs after
viral challenge. At week 17 naïve and INO-4800 immunized (5 per group) rhesus
macaques
were challenged by intranasal and intracheal administration of 1.1 x 104 PFU
SARS-CoV-2
(US-WA1 isolate). Figure 40A and Figure 40D: Log sgmRNA copies/ml in BAL
(Figure
40A), and NS copies/swab (Figure 40D) were measured at multiple timepoints
following
challenge in naïve (left panels) and INO-4800 vaccinated (right panels)
animals. Figure 40B
and Figure 40E: Peak viral loads (Between days 1 to 7) in BAL (Figure 40B) and
NS
(Figure 40E) following challenge. Figure 40C and Figure 40F: Viral RNA in BAL
and NS
at day 7 after challenge. Blue and Red lines reflect median viral loads. Mann-
Whitney test P
values are provided (Figure 40B and Figure 40C).
[0062] DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[0063] Definitions
[0064] Unless otherwise defined, all technical and scientific terms used
herein have the
same meaning as commonly understood by one of ordinary skill in the art. In
case of conflict,
the present document, including definitions, will control. Preferred methods
and materials are
described below, although methods and materials similar or equivalent to those
described
herein can be used in practice or testing of the present invention. All
publications, patent
applications, patents and other references mentioned herein are incorporated
by reference in
their entirety. The materials, methods, and examples disclosed herein are
illustrative only and
not intended to be limiting.
100651 The term -comprising" is intended to include examples encompassed by
the terms
"consisting essentially of' and "consisting of'; similarly, the term
"consisting essentially of'
is intended to include examples encompassed by the term "consisting of" The
present
disclosure also contemplates other embodiments "comprising," "consisting of'
and
- 15 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
"consisting essentially of" the embodiments or elements presented herein,
whether explicitly
set forth or not.
[0066] It is to be appreciated that certain features of the disclosed
materials and methods
which are, for clarity, described herein in the context of separate
embodiments, may also be
provided in combination in a single embodiment. Conversely, various features
of the
disclosed materials and methods that are, for brevity, described in the
context of a single
embodiment, may also be provided separately or in any subcombination.
[0067] The singular forms -a," "and" and "the" include plural references
unless the context
clearly dictates otherwise.
[0068] The term "about" when used in reference to numerical ranges, cutoffs,
or specific
values is used to indicate that the recited values may vary by up to as much
as 10% from the
listed value. Thus, the term -about" is used to encompass variations of 10%
or less,
variations of 5% or less, variations of 1% or less, variations of 0.5%
or less, or
variations of 0.1% or less from the specified value. When values are
expressed as
approximations by use of the antecedent "about," it will be understood that
the particular
value forms another embodiment. Reference to a particular numerical value
includes at least
that particular value unless the context clearly dictates otherwise.
[0069] "Adjuvant- as used herein means any molecule added to the vaccine
described
herein to enhance the immunogenicity of the antigen.
[0070] "Antibody" as used herein means an antibody of classes IgG, IgM, IgA,
IgD or IgE,
or fragments, fragments or derivatives thereof, including Fab, F(ab') 2, Fd,
and single chain
antibodies, diabodies, bispecific antibodies, bifunctional antibodies and
derivatives thereof
The antibody can be an antibody isolated from the serum sample of mammal, a
polyclonal
antibody, affinity purified antibody, or mixtures thereof which exhibits
sufficient binding
specificity to a desired epitope or a sequence derived therefrom.
100711 The term "biosimilar" (of an approved reference product/biological
drug, i.e.,
reference listed drug) refers to a biological product that is highly similar
to the reference
product notwithstanding minor differences in clinically inactive components
with no
clinically meaningful differences between the biosimilar and the reference
product in terms of
safety, purity and potency, based upon data derived from (a) analytical
studies that
demonstrate that the biological product is highly similar to the reference
product
notwithstanding minor differences in clinically inactive components; (b)
animal studies
(including the assessment of toxicity); and/or (c) a clinical study or studies
(including the
assessment of immunogenicity and pharmacokinetics or pharmacodynamics) that
are
- 16 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
sufficient to demonstrate safety, purity, and potency in one or more
appropriate conditions of
use for which the reference product is licensed and intended to be used and
for which
licensure is sought for the biosimilar. The biosimilar may be an
interchangeable product that
may be substituted for the reference product at the pharmacy without the
intervention of the
prescribing healthcare professional. To meet the additional standard of
"interchangeability,"
the biosimilar is to be expected to produce the same clinical result as the
reference product in
any given patient and, if the biosimilar is administered more than once to an
individual, the
risk in terms of safety or diminished efficacy of alternating or switching
between the use of
the biosimilar and the reference product is not greater than the risk of using
the reference
product without such alternation or switch. The biosimilar utilizes the same
mechanisms of
action for the proposed conditions of use to the extent the mechanisms are
known for the
reference product. The condition or conditions of use prescribed, recommended,
or suggested
in the labeling proposed for the biosimilar have been previously approved for
the reference
product. The route of administration, the dosage form, and/or the strength of
the biosimilar
are the same as those of the reference product and the biosimilar is
manufactured, processed,
packed or held in a facility that meets standards designed to assure that the
biosimilar
continues to be safe, pure and potent. The biosimilar may include minor
modifications in the
amino acid sequence when compared to the reference product, such as N- or C-
terminal
truncations that are not expected to change the biosimilar performance.
[0072] "Coding sequence" or "encoding nucleic acid" as used herein means the
nucleic
acids (RNA or DNA molecule) that comprise a nucleotide sequence which encodes
a protein.
The coding sequence can further include initiation and termination signals
operably linked to
regulatory elements including a promoter and polyadenylation signal capable of
directing
expression in the cells of an individual or mammal to which the nucleic acid
is administered.
[0073] -Complement" or -complementary" as used herein means Watson-Crick
(e.g., A-
T/U and C-G) or Hoogsteen base pairing between nucleotides or nucleotide
analogs of
nucleic acid molecules.
[0074] "Consensus" or "Consensus Sequence" as used herein may mean a synthetic
nucleic
acid sequence, or corresponding polypeptide sequence, constructed based on
analysis of an
alignment of multiple subtypes of a particular antigen. The sequence may be
used to induce
broad immunity against multiple subtypes, serotypes, or strains of a
particular antigen.
Synthetic antigens, such as fusion proteins, may be manipulated to generate
consensus
sequences (or consensus antigens).
- 17 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0075] "Electroporation;' "electro-permeabilization," or "electro-kinetic
enhancement"
("EP") as used interchangeably herein means the use of a transmembrane
electric field pulse
to induce microscopic pathways (pores) in a bio-membrane; their presence
allows
biomolecules such as plasmids, oligonucleotides, siRNA, drugs, ions, and water
to pass from
one side of the cellular membrane to the other.
[0076] "Fragment" as used herein means a nucleic acid sequence or a portion
thereof that
encodes a polypeptide capable of eliciting an immune response in a mammal. The
fragments
can be DNA fragments selected from at least one of the various nucleotide
sequences that
encode protein fragments set forth below.
[0077] "Fragment" or "immunogenic fragment" with respect to polypeptide
sequences
means a polypeptide capable of eliciting an immune response in a mammal that
cross reacts
with a full-length wild type strain SARS-CoV-2 antigen. Fragments of consensus
proteins
can comprise at least 10%, at least 20%, at least 30%, at least 40%, at least
50%, at least
60%, at least 70%, at least 80%, at least 90% or at least 95% of a consensus
protein. In some
embodiments, fragments of consensus proteins can comprise at least 20 amino
acids or more,
at least 30 amino acids or more, at least 40 amino acids or more, at least 50
amino acids or
more, at least 60 amino acids or more, at least 70 amino acids or more, at
least 80 amino
acids or more, at least 90 amino acids or more, at least 100 amino acids or
more, at least 110
amino acids or more, at least 120 amino acids or more, at least 130 amino
acids or more, at
least 140 amino acids or more, at least 150 amino acids or more, at least 160
amino acids or
more, at least 170 amino acids or more, at least 180 amino acids or more, at
least 190 amino
acids or more, at least 200 amino acids or more, at least 210 amino acids or
more, at least 220
amino acids or more, at least 230 amino acids or more, or at least 240 amino
acids or more of
a consensus protein.
[0078] As used herein, the term -genetic construct" refers to the DNA or RNA
molecules
that comprise a nucleotide sequence which encodes a protein. The coding
sequence includes
initiation and termination signals operably linked to regulatory elements
including a promoter
and polyadenylation signal capable of directing expression in the cells of the
individual to
whom the nucleic acid molecule is administered. As used herein, the term -
expressible form"
refers to gene constructs that contain the necessary regulatory elements
operable linked to a
coding sequence that encodes a protein such that when present in the cell of
the individual,
the coding sequence will be expressed.
[0079] "Identical" or "identity" as used herein in the context of two or more
nucleic acids
or polypeptide sequences, means that the sequences have a specified percentage
of residues
- 18 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
that are the same over a specified region. The percentage can be calculated by
optimally
aligning the two sequences, comparing the two sequences over the specified
region,
determining the number of positions at which the identical residue occurs in
both sequences
to yield the number of matched positions, dividing the number of matched
positions by the
total number of positions in the specified region, and multiplying the result
by 100 to yield
the percentage of sequence identity. In cases where the two sequences are of
different lengths
or the alignment produces one or more staggered ends and the specified region
of comparison
includes only a single sequence, the residues of single sequence are included
in the
denominator but not the numerator of the calculation. When comparing DNA and
RNA,
thymine (T) and uracil (U) can be considered equivalent. Identity can be
performed manually
or by using a computer sequence algorithm such as BLAST or BLAST 2Ø
[0080] -Immune response" as used herein means the activation of a host's
immune system,
e.g., that of a mammal, in response to the introduction of antigen. The immune
response can
be in the form of a cellular or humoral response, or both.
[0081] "Nucleic acid" or "oligonucleotide" or "polynucleotide" or "nucleic
acid molecule"
as used herein means at least two nucleotides covalently linked together. The
depiction of a
single strand also defines the sequence of the complementary strand. Thus, a
nucleic acid also
encompasses the complementary strand of a depicted single strand. Many
variants of a
nucleic acid can be used for the same purpose as a given nucleic acid. Thus, a
nucleic acid
also encompasses substantially identical nucleic acids and complements thereof
A single
strand provides a probe that can hybridize to a target sequence under
stringent hybridization
conditions. Thus, a nucleic acid also encompasses a probe that hybridizes
under stringent
hybridization conditions.
[0082] Nucleic acids can be single stranded or double-stranded or can contain
portions of
both double-stranded and single-stranded sequence. The nucleic acid can be
DNA, both
genomic and cDNA, RNA, or a hybrid, where the nucleic acid can contain
combinations of
deoxyribo- and ribo-nucleotides, and combinations of bases including uracil,
adenine,
thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and
isoguanine.
Nucleic acids can be obtained by chemical synthesis methods or by recombinant
methods.
100831 "Operably linked- as used herein means that expression of a gene is
under the
control of a promoter with which it is spatially connected. A promoter can be
positioned 5'
(upstream) or 3' (downstream) of a gene under its control. The distance
between the promoter
and a gene can be approximately the same as the distance between that promoter
and the gene
- 19 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
it controls in the gene from which the promoter is derived. As is known in the
art, variation in
this distance can be accommodated without loss of promoter function.
[0084] A "peptide," -protein," or "polypeptide" as used herein can mean a
linked sequence
of amino acids and can be natural, synthetic, or a modification or combination
of natural and
synthetic.
[0085] "Promoter" as used herein means a synthetic or naturally derived
molecule which is
capable of conferring, activating or enhancing expression of a nucleic acid in
a cell. A
promoter can comprise one or more specific transcriptional regulatory
sequences to further
enhance expression and/or to alter the spatial expression and/or temporal
expression of same.
A promoter can also comprise distal enhancer or repressor elements, which can
be located as
much as several thousand base pairs from the start site of transcription. A
promoter can be
derived from sources including viral, bacterial, fungal, plants, insects, and
animals. A
promoter can regulate the expression of a gene component constitutively or
differentially
with respect to cell, the tissue or organ in which expression occurs or, with
respect to the
developmental stage at which expression occurs, or in response to external
stimuli such as
physiological stresses, pathogens, metal ions, or inducing agents.
Representative examples of
promoters include the bacteriophage T7 promoter, bacteriophage T3 promoter,
SP6 promoter,
lac operator-promoter, tac promoter, SV40 late promoter, SV40 early promoter,
RSV-LTR
promoter, and CMV IE promoter.
[0086] "Signal peptide" and "leader sequence" are used interchangeably herein
and refer to
an amino acid sequence that can be linked at the amino terminus of a SARS-CoV-
2 protein
set forth herein. Signal peptides/leader sequences typically direct
localization of a protein.
Signal peptides/leader sequences used herein preferably facilitate secretion
of the protein
from the cell in which it is produced. Signal peptides/leader sequences are
often cleaved from
the remainder of the protein, often referred to as the mature protein, upon
secretion from the
cell. Signal peptides/leader sequences are linked at the N terminus of the
protein.
[0087] "Subject" as used herein can mean a mammal that wants or is in need of
being
immunized with a herein described immunogenic composition or vaccine. The
mammal can
be a human, chimpanzee, guinea pig, dog, cat, horse, cow, mouse, rabbit, or
rat.
100881 "Substantially identical- as used herein can mean that a first and
second amino acid
sequence are at least 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%,
87%,
88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% over a region of
1, 2,
3,4, 5,6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24,
25, 30, 35, 40, 45,
50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 600, 700,
800, 900, 1000, 1100
- 20 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
or more amino acids. Substantially identical can also mean that a first
nucleic acid sequence
and a second nucleic acid sequence are at least 60%, 65%, 70%, 75%, 80%, 81%,
82%, 83%,
84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or
99% over a region of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,
17, 18, 19, 20, 21, 22,
23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200,
300, 400, 500, 600,
700, 800, 900, 1000, 1100 or more nucleotides.
[0089] "Treatment- or "treating,- as used herein can mean protecting of an
animal from a
disease through means of preventing, suppressing, repressing, or completely
eliminating the
disease. Preventing the disease involves administering an immunogenic
composition or a
vaccine of the present invention to an animal prior to onset of the disease.
Suppressing the
disease involves administering an immunogenic composition or a vaccine of the
present
invention to an animal after induction of the disease but before its clinical
appearance.
Repressing the disease involves administering an immunogenic composition or a
vaccine of
the present invention to an animal after clinical appearance of the disease.
[0090] As used herein, unless otherwise noted, the term "clinically proven"
(used
independently or to modify the terms "safe" and/or "effective") shall mean
that it has been
proven by a clinical trial wherein the clinical trial has met the approval
standards of U.S.
Food and Drug Administration, EMA or a corresponding national regulatory
agency. For
example, proof may be provided by the clinical trial(s) described in the
examples provided
herein.
[0091] The term "clinically proven safe", as it relates to a dose, dosage
regimen, treatment
or method with a SARS-CoV-2 antigen (for example, a SARS-CoV-2 spike antigen
administered as pGX9501 or INO-4800 or a biosimilar thereof) refers to a
favorable
risk:benefit ratio with an acceptable frequency and/or acceptable severity of
treatment-
emergent adverse events (referred to as AEs or TEAEs) compared to the standard
of care or
to another comparator. An adverse event is an untoward medical occurrence in a
patient
administered a medicinal product. One index of safety is the National Cancer
Institute (NCI)
incidence of adverse events (AE) graded per Common Toxicity Criteria for
Adverse Events
CTCAE v4.03.
100921 The terms "clinically proven efficacy" and "clinically proven
effective" as used
herein in the context of a dose, dosage regimen, treatment or method refer to
the effectiveness
of a particular dose, dosage or treatment regimen. Efficacy can be measured
based on change
in the course of the disease in response to an agent of the present invention.
For example, a
SARS-CoV-2 antigen (for example, a SARS-CoV-2 spike antigen administered as
pGX9501
- 21 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
or INO-4800 or a biosimilar thereof) is administered to a patient in an amount
and for a time
sufficient to induce an improvement, preferably a sustained improvement, in at
least one
indicator that reflects the severity of the disorder that is being treated.
Various indicators that
reflect the extent of the subject's illness, disease or condition may be
assessed for determining
whether the amount and time of the treatment is sufficient. Such indicators
include, for
example, clinically recognized indicators of disease severity, symptoms, or
manifestations of
the disorder in question. The degree of improvement generally is determined by
a physician,
who may make this determination based on signs, symptoms, biopsies, or other
test results,
and who may also employ questionnaires that are administered to the subject,
such as quality-
of-life questionnaires developed for a given disease. For example, a SARS-CoV-
2 antigen
(for example, a SARS-CoV-2 spike antigen administered as pGX9501 or INO-4800
or a
biosimilar thereof) may be administered to achieve an improvement in a
patient's condition
related to SARS-CoV-2 infection. Improvement may be indicated by an
improvement in an
index of disease activity, by amelioration of clinical symptoms or by any
other measure of
disease activity.
[0093] -Variant" used herein with respect to a nucleic acid means (i) a
portion or fragment
of a referenced nucleotide sequence; (ii) the complement of a referenced
nucleotide sequence
or portion thereof; (iii) a nucleic acid that is substantially identical to a
referenced nucleic
acid or the complement thereof; or (iv) a nucleic acid that hybridizes under
stringent
conditions to the referenced nucleic acid, complement thereof, or a sequences
substantially
identical thereto.
[0094] Variant can further be defined as a peptide or polypeptide that differs
in amino acid
sequence by the insertion, deletion, or conservative substitution of amino
acids, but retain at
least one biological activity. Representative examples of "biological
activity" include the
ability to be bound by a specific antibody or to promote an immune response.
Variant can
also mean a protein with an amino acid sequence that is substantially
identical to a referenced
protein with an amino acid sequence that retains at least one biological
activity. A
conservative substitution of an amino acid, i.e., replacing an amino acid with
a different
amino acid of similar properties (e.g., hydrophilicity, degree and
distribution of charged
regions) is recognized in the art as typically involving a minor change. These
minor changes
can be identified, in part, by considering the hydropathic index of amino
acids, as understood
in the art. Kyte et !Vol. Biol. 157:105-132 (1982). The hydropathic
index of an amino
acid is based on a consideration of its hydrophobicity and charge. It is known
in the art that
amino acids of similar hydropathic indexes can be substituted and still retain
protein function.
- 22 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
In one aspect, amino acids having hydropathic indexes of +2 are substituted.
The
hydrophilicity of amino acids can also be used to reveal substitutions that
would result in
proteins retaining biological function. A consideration of the hydrophilicity
of amino acids in
the context of a peptide permits calculation of the greatest local average
hydrophilicity of that
peptide, a useful measure that has been reported to correlate well with
antigenicity and
immunogenicity. Substitution of amino acids having similar hydrophilicity
values can result
in peptides retaining biological activity, for example immunogenicity, as is
understood in the
art. Substitutions can be performed with amino acids having hydrophilicity
values within 2
of each other. Both the hydrophobicity index and the hydrophilicity value of
amino acids are
influenced by the particular side chain of that amino acid. Consistent with
that observation,
amino acid substitutions that are compatible with biological function are
understood to
depend on the relative similarity of the amino acids, and particularly the
side chains of those
amino acids, as revealed by the hydrophobicity, hydrophilicity, charge, size,
and other
properties.
[0095] A variant may be a nucleic acid sequence that is substantially
identical over the full
length of the full gene sequence or a fragment thereof The nucleic acid
sequence may be
80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,
95%,
96%, 97%, 98%, 99%, or 100% identical over the full length of the gene
sequence or a
fragment thereof A variant may be an amino acid sequence that is substantially
identical over
the full length of the amino acid sequence or fragment thereof The amino acid
sequence may
be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%,
95%, 96%, 97%, 98%, 99%, or 100% identical over the full length of the amino
acid
sequence or a fragment thereof
[0096] "Vector" as used herein means a nucleic acid sequence containing an
origin of
replication. A vector can be a viral vector, bacteriophage, bacterial
artificial chromosome or
yeast artificial chromosome. A vector can be a DNA or RNA vector. A vector can
be a self-
replicating extrachromosomal vector, and preferably, is a DNA plasmid.
[0097] For the recitation of numeric ranges herein, each intervening number
there between
with the same degree of precision is explicitly contemplated. For example, for
the range of 6-
9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the
range 6.0-7.0, the
number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are
explicitly contemplated.
[0098] Nucleic Acid Molecules, Antigens, and Immunogenic Compositions
- 23 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0099] Provided herein are immunogenic compositions, such as vaccines,
comprising a
nucleic acid molecule encoding a SARS-CoV-2 antigen, a fragment thereof, a
variant thereof,
or a combination thereof Also provided herein are immunogenic compositions,
such as
vaccines, comprising a SARS-CoV-2 antigen, a fragment thereof, a variant
thereof, or a
combination thereof The immunogenic compositions can be used to protect
against and treat
any number of strains of SARS-CoV-2, thereby treating, preventing, and/or
protecting against
SARS-CoV-2-based pathologies. The immunogenic compositions can significantly
induce an
immune response of a subject administered the immunogenic compositions,
thereby
protecting against and treating SARS-CoV-2 infection.
[0100] The immunogenic composition can be a DNA vaccine, a peptide vaccine, or
a
combination DNA and peptide vaccine. The DNA vaccine can include a nucleic
acid
molecule encoding the SARS-CoV-2 antigen. The nucleic acid molecule can be
DNA, RNA,
cDNA, a variant thereof, a fragment thereof, or a combination thereof. The
nucleic acid
molecule can also include additional sequences that encode linker, leader, or
tag sequences
that are linked to the nucleic acid molecule encoding the SARS-CoV-2 antigen
by a peptide
bond. The peptide vaccine can include a SARS-CoV-2 antigenic peptide, a SARS-
CoV-2
antigenic protein, a variant thereof, a fragment thereof, or a combination
thereof The
combination DNA and peptide vaccine can include the above described nucleic
acid molecule
encoding the SARS-CoV-2 antigen and the SARS-CoV-2 antigenic peptide or
protein, in
which the SARS-CoV-2 antigenic peptide or protein and the encoded SARS-CoV-2
antigen
have the same amino acid sequence.
[0101] The disclosed immunogenic compositions can elicit both humoral and
cellular
immune responses that target the SARS-CoV-2 antigen in the subject
administered the
immunogenic composition. The disclosed immunogenic compositions can elicit
neutralizing
antibodies and immunoglobulin G (IgG) antibodies that are reactive with the
SARS-CoV-2
spike antigen. The immunogenic composition can also elicit CD8+ and CD4+ T
cell
responses that are reactive to the SARS-CoV-2 antigen and produce interferon-
gamma (IFN-
y), tumor necrosis factor alpha (INF-a), and interleukin-2 (IL-2).
[0102] The immunogenic composition can induce a humoral immune response in the
subject administered the immunogenic composition. The induced humoral immune
response
can be specific for the SARS-CoV-2 antigen. The induced humoral immune
response can be
reactive with the SARS-CoV-2 antigen. The humoral immune response can be
induced in the
subject administered the vaccine by about 1.5-fold to about 16-fold, about 2-
fold to about 12-
fold, or about 3-fold to about 10-fold. The humoral immune response can be
induced in the
- 24 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
subject administered the vaccine by at least about 1.5-fold, at least about
2.0-fold, at least
about 2.5-fold, at least about 3.0-fold, at least about 3.5-fold, at least
about 4.0-fold, at least
about 4.5-fold, at least about 5.0-fold, at least about 5.5-fold, at least
about 6.0-fold, at least
about 6.5-fold, at least about 7.0-fold, at least about 7.5-fold, at least
about 8.0-fold, at least
about 8.5-fold, at least about 9.0-fold, at least about 9.5-fold, at least
about 10.0-fold, at least
about 10.5-fold, at least about 11.0-fold, at least about 11.5-fold, at least
about 12.0-fold, at
least about 12.5-fold, at least about 13.0-fold, at least about 13.5-fold, at
least about 14.0-
fold, at least about 14.5-fold, at least about 15.0-fold, at least about 15.5-
fold, or at least
about 16.0-fold.
[0103] The humoral immune response induced by the immunogenic composition can
include an increased level of neutralizing antibodies associated with the
subject administered
the immunogenic composition as compared to a subject not administered the
immunogenic
composition. The neutralizing antibodies can be specific for the SARS-CoV-2
antigen. The
neutralizing antibodies can be reactive with the SARS-CoV-2 antigen. The
neutralizing
antibodies can provide protection against and/or treatment of SARS-CoV-2
infection and its
associated pathologies in the subject administered the immunogenic
composition.
[0104] The humoral immune response induced by the immunogenic composition can
include an increased level of IgG antibodies associated with the subject
administered the
immunogenic composition as compared to a subject not administered the
immunogenic
composition. These IgG antibodies can be specific for the SARS-CoV-2 antigen.
These IgG
antibodies can be reactive with the SARS-CoV-2 antigen. The level of IgG
antibody
associated with the subject administered the immunogenic composition can be
increased by
about 1.5-fold to about 16-fold, about 2-fold to about 12-fold, or about 3-
fold to about 10-
fold as compared to the subject not administered the immunogenic composition.
The level of
IgG antibody associated with the subject administered the immunogenic
composition can be
increased by at least about 1.5-fold, at least about 2.0-fold, at least about
2.5-fold, at least
about 3.0-fold, at least about 3.5-fold, at least about 4.0-fold, at least
about 4.5-fold, at least
about 5.0-fold, at least about 5.5-fold, at least about 6.0-fold, at least
about 6.5-fold, at least
about 7.0-fold, at least about 7.5-fold, at least about 8.0-fold, at least
about 8.5-fold, at least
about 9.0-fold, at least about 9.5-fold, at least about 10.0-fold, at least
about 10.5-fold, at
least about 11.0-fold, at least about 11.5-fold, at least about 12.0-fold, at
least about 12.5-
fold, at least about 13.0-fold, at least about 13.5-fold, at least about 14.0-
fold, at least about
14.5-fold, at least about 15.0-fold, at least about 15.5-fold, or at least
about 16.0-fold as
compared to the subject not administered the immunogenic composition.
- 25 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0105] The immunogenic composition can induce a cellular immune response in
the subject
administered the immunogenic composition. The induced cellular immune response
can be
specific for the SARS-CoV-2 antigen. The induced cellular immune response can
be reactive
to the SARS-CoV-2 antigen. The induced cellular immune response can include
eliciting a
CD8+ T cell response. The elicited CD8+ T cell response can be reactive with
the SARS-
CoV-2 antigen. The elicited CD8+ T cell response can be polyfunctional. The
induced
cellular immune response can include eliciting a CD8+ T cell response, in
which the CD8+ T
cells produce interferon-gamma (IFN-y), tumor necrosis factor alpha (INF-a),
interleukin-2
(IL-2), or a combination of IFN-y and TNF-a.
[0106] The induced cellular immune response can include an increased CD8+ T
cell
response associated with the subject administered the immunogenic composition
as compared
to the subject not administered the immunogenic composition. The CD8+ T cell
response
associated with the subject administered the immunogenic composition can be
increased by
about 2-fold to about 30-fold, about 3-fold to about 25-fold, or about 4-fold
to about 20-fold
as compared to the subject not administered the immunogenic composition. The
CD8+ T cell
response associated with the subject administered the immunogenic composition
can be
increased by at least about 1.5-fold, at least about 2.0-fold, at least about
3.0-fold, at least
about 4.0-fold, at least about 5.0-fold, at least about 6.0-fold, at least
about 6.5-fold, at least
about 7.0-fold, at least about 7.5-fold, at least about 8.0-fold, at least
about 8.5-fold, at least
about 9.0-fold, at least about 9.5-fold, at least about 10.0-fold, at least
about 10.5-fold, at
least about 11.0-fold, at least about 11.5-fold, at least about 12.0-fold, at
least about 12.5-
fold, at least about 13.0-fold, at least about 13.5-fold, at least about 14.0-
fold, at least about
14.5-fold, at least about 15.0-fold, at least about 16.0-fold, at least about
17.0-fold, at least
about 18.0-fold, at least about 19.0-fold, at least about 20.0-fold, at least
about 21.0-fold, at
least about 22.0-fold, at least about 23.0-fold, at least about 24.0-fold, at
least about 25.0-
fold, at least about 26.0-fold, at least about 27.0-fold, at least about 28.0-
fold, at least about
29.0-fold, or at least about 30.0-fold as compared to the subject not
administered the
immunogenic composition.
[0107] The induced cellular immune response can include an increased frequency
of
CD3+CD8+ T cells that produce IFN-y. The frequency of CD3+CD8+IFN-y+ T cells
associated with the subject administered the immunogenic composition can be
increased by at
least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-
fold, 11-fold, 12-
fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or 20-
fold as compared to
the subject not administered the immunogenic composition.
- 26 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0108] The induced cellular immune response can include an increased frequency
of
CD3+CD8+ T cells that produce TNF-a. The frequency of CD3+CD8-hTNF-a+ T cells
associated with the subject administered the immunogenic composition can be
increased by at
least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-
fold, 11-fold, 12-
fold, 13-fold, or 14-fold as compared to the subject not administered the
immunogenic
composition.
[0109] The induced cellular immune response can include an increased frequency
of
CD3+CD8+ T cells that produce IL-2. The frequency of CD3+CD8+IL-2+ T cells
associated
with the subject administered the immunogenic composition can be increased by
at least
about 0.5-fold, 1.0-fold, 1.5-fold, 2.0-fold, 2.5-fold, 3.0-fold, 3.5-fold,
4.0-fold, 4.5-fold, or
5.0-fold as compared to the subject not administered the immunogenic
composition.
[0110] The induced cellular immune response can include an increased frequency
of
CD3+CD8+ T cells that produce both IFN-y and TNF-a. The frequency of
CD3+CD8+IFN-
y+TNF-a+ T cells associated with the subject administered the immunogenic
composition
can be increased by at least about 25-fold, 30-fold, 35-fold, 40-fold, 45-
fold, 50-fold, 55-fold,
60-fold, 65-fold, 70-fold, 75-fold, 80-fold, 85-fold, 90-fold, 95-fold, 100-
fold, 110-fold, 120-
fold, 130-fold, 140-fold, 150-fold, 160-fold, 170-fold, or 180-fold as
compared to the subject
not administered the immunogenic composition.
[0111] The cellular immune response induced by the immunogenic composition can
include eliciting a CD4+ T cell response. The elicited CD4+ T cell response
can be reactive
with the SARS-CoV-2 antigen. The elicited CD4+ T cell response can be
polyfunctional. The
induced cellular immune response can include eliciting a CD4+ T cell response,
in which the
CD4+ T cells produce IFN-y, TNF-a, IL-2, or a combination of IFN-y and TNF-a.
[0112] The induced cellular immune response can include an increased frequency
of
CD3+CD4+ T cells that produce IFN-y. The frequency of CD3+CD4+IFN-y+ T cells
associated with the subject administered the immunogenic composition can be
increased by at
least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-
fold, 11-fold, 12-
fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or 20-
fold as compared to
the subject not administered the immunogenic composition.
101131 The induced cellular immune response can include an increased frequency
of
CD3+CD4+ T cells that produce TNF-a. The frequency of CD3+CD4+TNF-a+ T cells
associated with the subject administered the immunogenic composition can be
increased by at
least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-
fold, 11-fold, 12-
- 27 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold,
21-fold, or 22-fold
as compared to the subject not administered the immunogenic composition.
[0114] The induced cellular immune response can include an increased frequency
of
CD3+CD4+ T cells that produce IL-2. The frequency of CD3+CD4+IL-2+ T cells
associated
with the subject administered the immunogenic composition can be increased by
at least
about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold,
11-fold, 12-fold,
13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 21-
fold, 22-fold, 23-
fold, 24-fold, 25-fold, 26-fold, 27-fold, 28-fold, 29-fold, 30-fold, 31-fold,
32-fold, 33-fold,
34-fold, 35-fold, 36-fold, 37-fold, 38-fold, 39-fold, 40-fold, 45-fold, 50-
fold, 55-fold, or 60-
fold as compared to the subject not administered the immunogenic composition.
[0115] The induced cellular immune response can include an increased frequency
of
CD3+CD4+ T cells that produce both IFN-y and TNF-a. The frequency of
CD3+CD4+IFN-
y+TNF-a+ associated with the subject administered the immunogenic composition
can be
increased by at least about 2-fold, 2.5-fold, 3.0-fold, 3.5-fold, 4.0-fold,
4.5-fold, 5.0-fold, 5.5-
fold, 6.0-fold, 6.5-fold, 7.0-fold, 7.5-fold, 8.0-fold, 8.5-fold, 9.0-fold,
9.5-fold, 10.0-fold,
10.5-fold, 11.0-fold, 11.5-fold, 12.0-fold, 12.5-fold, 13.0-fold, 13.5-fold,
14.0-fold, 14.5-fold,
15.0-fold, 15.5-fold, 16.0-fold, 16.5-fold, 17.0-fold, 17.5-fold, 18.0-fold,
18.5-fold, 19.0-fold,
19.5-fold, 20.0-fold, 21-fold, 22-fold, 23-fold 24-fold, 25-fold, 26-fold, 27-
fold, 28-fold, 29-
fold, 30-fold, 31-fold, 32-fold, 33-fold, 34-fold, or 35-fold as compared to
the subject not
administered the immunogenic composition.
[0116] The immunogenic composition of the present invention can have features
required
of effective immunogenic compositions such as being safe so the immunogenic
composition
itself does not cause illness or death; is protective against illness
resulting from exposure to
live pathogens such as viruses or bacteria; induces neutralizing antibody to
prevent invention
of cells; induces protective T cells against intracellular pathogens; and
provides ease of
administration, few side effects, biological stability, and low cost per dose.
[0117] The immunogenic composition can further induce an immune response when
administered to different tissues such as the muscle or skin. The immunogenic
composition
can further induce an immune response when parenterally administered, for
example by
subcutaneous, intradermal, or intramuscular injection, optionally followed by
electroporation
as described herein.
[0118] a. SARS-CoV-2 Antigen and Nucleic Acid Molecules Encoding the Same
- 28 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0119] As described above, provided herein are immunogenic compositions
comprising a
nucleic acid molecule encoding a SARS-CoV-2 antigen, a fragment thereof, a
variant thereof,
or a combination thereof Also provided herein are immunogenic compositions
comprising a
SARS-CoV-2 antigen, a fragment thereof, a variant thereof, or a combination
thereof
[0120] Upon binding cell surface proteins and membrane fusion, the coronavirus
enters the
cell and its singled-stranded RNA genome is released into the cytoplasm of the
infected cell.
The singled-stranded RNA genome is a positive strand and thus, can be
translated into a RNA
polymerase, which produces additional viral RNAs that are minus strands.
Accordingly, the
SARS-CoV-2 antigen can also be a SARS-CoV-2 RNA polymerase.
[0121] The viral minus RNA strands are transcribed into smaller, subgenomic
positive
RNA strands, which are used to translate other viral proteins, for example,
nucleocapsid (N)
protein, envelope (E) protein, and matrix (M) protein. Accordingly, the SARS-
CoV-2 antigen
can comprise a SARS-CoV-2 nucleocapsid protein, a SARS-CoV-2 envelope protein,
or a
SARS-CoV-2 matrix protein.
[0122] The viral minus RNA strands can also he used to replicate the viral
genome, which
is bound by nucleocapsid protein. Matrix protein, along with spike protein, is
integrated into
the endoplasmic reticulum of the infected cell. Together, the nucleocapsid
protein bound to
the viral genome and the membrane-embedded matrix and spike proteins are
budded into the
lumen of the endoplasmic reticulum, thereby encasing the viral genome in a
membrane. The
viral progeny are then transported by golgi vesicles to the cell membrane of
the infected cell
and released into the extracellular space by endocytosis.
[0123] Coronaviruses, including SARS-CoV-2, are encapsulated by a membrane and
have
a type 1 membrane glycoprotein known as spike (S) protein, which forms
protruding spikes
on the surface of the coronavirus. The SARS-CoV-2 S protein is a class I
membrane fusion
protein, which is the major envelope protein on the surface of coronaviruses.
The spike
protein facilitates binding of the coronavirus to proteins located on the
surface of a cell, for
example, the metalloprotease amino peptidase N, and mediates cell-viral
membrane fusion. In
particular, the spike protein contains an Si subunit that facilitates binding
of the coronavirus
to cell surface proteins. Accordingly, the Si subunit of the spike protein
controls which cells
are infected by the coronavirus. The spike protein also contains a S2 subunit,
which is a
transmembrane subunit that facilitates viral and cellular membrane fusion.
Accordingly, the
SARS-CoV-2 antigen can comprise a SARS-CoV-2 spike protein, a Si subunit of a
SARS-
CoV-2 spike protein, a S2 subunit of a SARS-CoV-2 spike protein, or a fragment
of the Si
subunit comprising the SARS-CoV-2 Spike Receptor Binding Domain.
- 29 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0124] In some embodiments, the SARS-CoV-2 antigen can be a SARS-CoV-2 spike
protein, a SARS-CoV-2 RNA polymerase, a SARS-CoV-2 nucleocapsid protein, a
SARS-
CoV-2 envelope protein, a SARS-CoV-2 matrix protein, a fragment thereof, a
variant thereof,
or a combination thereof
[0125] The SARS-CoV-2 antigen can be a SARS-CoV-2 spike antigen, a fragment
thereof,
a variant thereof, or a combination thereof The SARS-CoV-2 spike antigen is
capable of
eliciting an immune response in a mammal against one or more SARS-CoV-2
strains. The
SARS-CoV-2 spike antigen can comprise an epitope(s) that makes it particularly
effective as
an immunogen against which an anti- SARS-CoV-2 immune response can be induced.
[0126] The SARS-CoV-2 antigen can be a consensus antigen derived from two or
more
strains of SARS-CoV-2. In some embodiments, the SARS-CoV-2 antigen is a SARS-
CoV-2
consensus spike antigen. The SARS-CoV-2 consensus spike antigen can be derived
from the
sequences of spike antigens from strains of SARS-CoV-2, and thus, the SARS-CoV-
2
consensus spike antigen is unique. In some embodiments, the SARS-CoV-2
consensus spike
antigen can be an outlier spike antigen, having a greater amino acid sequence
divergence
from other SARS-CoV-2 spike proteins. Accordingly, the immunogenic
compositions of the
present invention are widely applicable to multiple strains of SARS-CoV-2
because of the
unique sequences of the SARS-CoV-2 consensus spike antigen. These unique
sequences
allow the vaccine to be universally protective against multiple strains of
SARS-CoV-2,
including genetically diverse variants of SARS-CoV-2. Nucleic acid molecules
encoding the
SARS-CoV-2 antigen can be modified for improved expression. Modification can
include
codon optimization, RNA optimization, addition of a kozak sequence for
increased
translation initiation, and/or the addition of an immunoglobulin leader
sequence to increase
the immunogenicity of the SARS-CoV-2 antigen. The SARS-CoV-2 spike antigen can
comprise a signal peptide such as an immunoglobulin signal peptide, for
example, but not
limited to, an immunoglobulin E (IgE) or immunoglobulin (IgG) signal peptide.
In some
embodiments, the SARS-CoV-2 spike antigen can comprise a hemagglutinin (HA)
tag. The
SARS-CoV-2 spike antigen can be designed to elicit stronger and broader
cellular and/or
humoral immune responses than a corresponding codon optimized spike antigen.
101271 In some embodiments, the SARS-CoV-2 antigen comprises an amino acid
sequence
having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity over an entire length
of
residues 19 to 1279 of SEQ ID NO: 1. In some embodiments the SARS-CoV-2
antigen
comprises the amino acid sequence set forth in residues 19 to 1279 of SEQ ID
NO: 1. In
- 30 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
some embodiments, the SARS-CoV-2 antigen comprises an amino acid sequence
having at
least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,
93%,
94%, 95%, 96%, 97%, 98%, 99% or 100% identity over an entire length of SEQ ID
NO: 1. In
some embodiments the SARS-CoV-2 antigen comprises the amino acid sequence of
SEQ ID
NO: 1. In some embodiments the nucleic acid molecule encoding the SARS-CoV-2
antigen
comprises the nucleotide sequence having at least about 80%, 81%, 82%, 83%,
84%, 85%,
86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%
identity to the sequence set forth in nucleotides 55 to 3837 of SEQ ID NO:2,
SEQ ID NO: 2,
or SEQ ID NO: 3.
[0128] In some embodiments the SARS-CoV-2 antigen comprises an amino acid
sequence
having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%,
91%,
92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity over an entire length
of
residues 19 to 1279 of SEQ ID NO: 4 or over an entire length of SEQ ID NO: 4.
In some
embodiments the SARS-CoV-2 antigen comprises the amino acid sequence set forth
in
residues 19 to 1279 of SEQ ID NO: 4. In some embodiments the SARS-CoV-2
antigen
comprises the amino acid sequence of SEQ ID NO: 4. In some embodiments the
nucleic acid
molecule encoding the SARS-CoV-2 antigen comprises: a nucleic acid sequence
having at
least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,
93%,
94%, 95%, 96%, 97%, 98%, 99% or 100% identity over an entire length of
nucleotides 55 to
3837 of SEQ ID NO: 5 or over an entire length of SEQ ID NO: 5; the nucleic
acid sequence
of nucleotides 55 to 3837 of SEQ ID NO: 5; the nucleic acid sequence of SEQ ID
NO: 5; a
nucleic acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%,
87%,
88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity
over
an entire length of SEQ ID NO: 6; or the nucleic acid sequence of SEQ ID NO:
6.
[0129] In some embodiments the SARS-CoV-2 antigen is operably linked to an IgE
leader
sequence. In some such embodiments, the SARS-CoV-2 antigen comprises the amino
acid
sequence set forth in SEQ ID NO: 1. In some embodiments, the SARS-CoV-2
antigen is
encoded by the nucleotide sequence set forth in SEQ ID NO:2 or SEQ ID NO: 3.
In some
embodiments in which the SARS-CoV-2 antigen includes an IgE leader, the SARS-
CoV-2
antigen comprises the amino acid sequence set forth in SEQ ID NO: 4. In some
such
embodiments, the SARS-CoV-2 antigen is encoded by the nucleotide sequence set
forth in
SEQ ID NO:5 or SEQ ID NO: 6.
[0130] Immunogenic fragments of SEQ ID NO:1 can be provided. Immunogenic
fragments
can comprise at least 60%, at least 65%, at least 70%, at least 75%, at least
80%, at least
- 31 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or
at least 99% of
SEQ ID NO: 1. In some embodiments, immunogenic fragments include a leader
sequence,
such as for example an immunoglobulin leader, such as the IgE leader. In some
embodiments, immunogenic fragments are free of a leader sequence.
[0131] Immunogenic fragments of proteins with amino acid sequences homologous
to
immunogenic fragments of SEQ ID NO:1 can be provided. Such immunogenic
fragments can
comprise at least 60%, at least 65%, at least 70%, at least 75%, at least 80%,
at least 85%, at
least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least
99% of proteins
that are 95% homologous to SEQ ID NO:l. Some embodiments relate to immunogenic
fragments that have 96% homology to the immunogenic fragments of consensus
protein
sequences herein. Some embodiments relate to immunogenic fragments that have
97%
homology to the immunogenic fragments of consensus protein sequences herein.
Some
embodiments relate to immunogenic fragments that have 98% homology to the
immunogenic
fragments of consensus protein sequences herein. Some embodiments relate to
immunogenic
fragments that have 99% homology to the immunogenic fragments of consensus
protein
sequences herein. In some embodiments, immunogenic fragments include a leader
sequence,
such as for example an immunoglobulin leader, such as the IgE leader. In some
embodiments, immunogenic fragments are free of a leader sequence.
[0132] Some embodiments relate to immunogenic fragments of SEQ ID NO: 1.
Immunogenic fragments can be at least 60%, at least 65%, at least 70%, at
least 75%, at least
80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at
least 98% or at
least 99% of SEQ ID NO: 1. Immunogenic fragments can be at least 95%, at least
96%, at
least 97% at least 98% or at least 99% homologous to fragments of SEQ ID NO:
1. In some
embodiments, immunogenic fragments include sequences that encode a leader
sequence, such
as for example an immunoglobulin leader, such as the IgE leader. In some
embodiments,
fragments are free of coding sequences that encode a leader sequence.
[0133] Immunogenic fragments of SEQ ID NO:4 can be provided. Immunogenic
fragments
can comprise at least 60%, at least 65%, at least 70%, at least 75%, at least
80%, at least
85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or
at least 99% of
SEQ ID NO:4. In some embodiments, immunogenic fragments include a leader
sequence,
such as for example an immunoglobulin leader, such as the IgE leader. In some
embodiments, immunogenic fragments are free of a leader sequence.
[0134] Immunogenic fragments of proteins with amino acid sequences homologous
to
immunogenic fragments of SEQ ID NO:4 can be provided. Such immunogenic
fragments can
- 32 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
comprise at least 60%, at least 65%, at least 70%, at least 75%, at least 80%,
at least 85%, at
least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least
99% of proteins
that are 95% homologous to SEQ ID NO:4. Some embodiments relate to immunogenic
fragments that have 96% homology to the immunogenic fragments of consensus
protein
sequences herein. Some embodiments relate to immunogenic fragments that have
97%
homology to the immunogenic fragments of consensus protein sequences herein.
Some
embodiments relate to immunogenic fragments that have 98% homology to the
immunogenic
fragments of consensus protein sequences herein. Some embodiments relate to
immunogenic
fragments that have 99% homology to the immunogenic fragments of consensus
protein
sequences herein. In some embodiments, immunogenic fragments include a leader
sequence,
such as for example an immunoglobulin leader, such as the IgE leader. In some
embodiments, immunogenic fragments are free of a leader sequence.
101351 Some embodiments relate to immunogenic fragments of SEQ ID NO:4.
Immunogenic fragments can be at least 60%, at least 65%, at least 70%, at
least 75%, at least
80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at
least 98% or at
least 99% of SEQ ID NO:4. Immunogenic fragments can be at least 95%, at least
96%, at
least 97% at least 98% or at least 99% homologous to fragments of SEQ ID NO:4.
In some
embodiments, immunogenic fragments include sequences that encode a leader
sequence, such
as for example an immunoglobulin leader, such as the IgE leader. In some
embodiments,
fragments are free of coding sequences that encode a leader sequence.
[0136] b. Vector
[0137] The immunogenic compositions can comprise one or more vectors that
include a
nucleic acid molecule encoding the SARS-CoV-2an1igen. The one or more vectors
can be
capable of expressing the antigen. The vector can have a nucleic acid sequence
containing an
origin of replication. The vector can be a plasmid, bacteriophage, bacterial
artificial
chromosome or yeast artificial chromosome. The vector can be either a self-
replicating
extrachromosomal vector or a vector which integrates into a host genome.
[0138] The one or more vectors can be an expression construct, which is
generally a
plasmid that is used to introduce a specific gene into a target cell. Once the
expression vector
is inside the cell, the protein that is encoded by the gene is produced by the
cellular-
transcription and translation machinery ribosomal complexes. The plasmid is
frequently
engineered to contain regulatory sequences that act as enhancer and promoter
regions and
- 33 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
lead to efficient transcription of the gene carried on the expression vector.
The vectors of the
present invention express large amounts of stable messenger RNA, and therefore
proteins.
101391 The vectors may have expression signals such as a strong promoter, a
strong
termination codon, adjustment of the distance between the promoter and the
cloned gene, and
the insertion of a transcription termination sequence and a PTIS (portable
translation
initiation sequence).
[0140] (1) Expression Vectors
[0141] The vector can be a circular plasmid or a linear nucleic acid. The
circular plasmid
and linear nucleic acid are capable of directing expression of a particular
nucleotide sequence
in an appropriate subject cell. The vector can have a promoter operably linked
to the antigen-
encoding nucleotide sequence, which may be operably linked to termination
signals. The
vector can also contain sequences required for proper translation of the
nucleotide sequence.
The vector comprising the nucleotide sequence of interest may be chimeric,
meaning that at
least one of its components is heterologous with respect to at least one of
its other
components. The expression of the nucleotide sequence in the expression
cassette may be
under the control of a constitutive promoter or of an inducible promoter,
which initiates
transcription only when the host cell is exposed to some particular external
stimulus. In the
case of a multicellular organism, the promoter can also be specific to a
particular tissue or
organ or stage of development.
[0142] (2) Circular and Linear Vectors
[0143] The vector may be a circular plasmid, which may transform a target cell
by
integration into the cellular genome or exist extrachromosomally (e.g.,
autonomous
replicating plasmid with an origin of replication).
101441 The vector can be pVAX, pcDNA3.0, pGX-0001, or provax, or any other
expression
vector capable of expressing DNA encoding the antigen and enabling a cell to
translate the
sequence to an antigen that is recognized by the immune system.
[0145] Also provided herein is a linear nucleic acid immunogenic composition,
or linear
expression cassette (-LEC-), that is capable of being efficiently delivered to
a subject via
electroporation and expressing one or more desired antigens. The LEC may be
any linear
DNA devoid of any phosphate backbone. The DNA may encode one or more antigens.
The
LEC may contain a promoter, an intron, a stop codon, and/or a polyadenylation
signal. The
expression of the antigen may be controlled by the promoter. The LEC may not
contain any
- 34 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
antibiotic resistance genes and/or a phosphate backbone. The LEC may not
contain other
nucleic acid sequences unrelated to the desired antigen gene expression.
[0146] The LEC may be derived from any plasmid capable of being linearized.
The
plasmid may be capable of expressing the antigen. The plasmid can be pNP
(Puerto Rico/34)
or pM2 (New Caledonia/99). The plasmid may be WLV009, pVAX, pcDNA3.0, or
provax,
or any other expression vector capable of expressing DNA encoding the antigen
and enabling
a cell to translate the sequence to an antigen that is recognized by the
immune system.
[0147] The LEC can be perM2. The LEC can be perNP. perNP and perMR can be
derived
from pNP (Puerto Rico/34) and pM2 (New Caledonia/99), respectively.
[0148] (3) Promoter, Intron, Stop Codon, and Polyadenylation Signal
[0149] The vector may have a promoter. A promoter may be any promoter that is
capable
of driving gene expression and regulating expression of the isolated nucleic
acid. Such a
promoter is a cis-acting sequence element required for transcription via a DNA
dependent
RNA polymerase, which transcribes the antigen sequence described herein.
Selection of the
promoter used to direct expression of a heterologous nucleic acid depends on
the particular
application. The promoter may be positioned about the same distance from the
transcription
start in the vector as it is from the transcription start site in its natural
setting. However,
variation in this distance may be accommodated without loss of promoter
function.
[0150] The promoter may be operably linked to the nucleic acid sequence
encoding the
antigen and signals required for efficient polyadenylation of the transcript,
ribosome binding
sites, and translation termination. The promoter may be a CMV promoter, SV40
early
promoter, SV40 later promoter, metallothionein promoter, murine mammary tumor
virus
promoter, Rous sarcoma virus promoter, polyhedrin promoter, or another
promoter shown
effective for expression in eukaryotic cells.
101511 The vector may include an enhancer and an intron with functional splice
donor and
acceptor sites. The vector may contain a transcription termination region
downstream of the
structural gene to provide for efficient termination. The termination region
may be obtained
from the same gene as the promoter sequence or may be obtained from different
genes.
101521 c. Excipients and Other Components of the Immunogenic compositions
[0153] The immunogenic compositions may further comprise a pharmaceutically
acceptable excipient. The pharmaceutically acceptable excipient can be
functional molecules
such as vehicles, carriers, buffers, or diluents. As used herein. "buffer"
refers to a buffered
- 35 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
solution that resists changes in pH by the action of its acid-base conjugate
components. The
buffer generally has a pH from about 4.0 to about 8.0, for example from about
5.0 to about
7Ø In some embodiments, the buffer is saline-sodium citrate (S SC) buffer.
In some
embodiments in which the immunogenic composition comprises a nucleic acid
molecule
encoding a SARS-CoV-2 spike antigen as described above, the immunogenic
composition
comprises 10 mg/ml of vector in buffer, for example but not limited to SSC
buffer. In some
embodiments, the immunogenic composition comprises 10 mg/mL of the DNA plasmid
pGX9501 or pGX9503 in buffer. In some embodiments, the immunogenic composition
is
stored at about 2 C to about 8 C. In some embodiments, the immunogenic
composition is
stored at room temperature. The immunogenic composition may be stored for at
least a year
at room temperature. In some embodiments, the immunogenic composition is
stable at room
temperature for at least a year, wherein stability is defined as a supercoiled
plasmid
percentage of at least about 80%. In some embodiments, the supercoiled plasmid
percentage
is at least about 85% following storage for at least a year at room
temperature.
[0154] The pharmaceutically acceptable excipient can be a transfection
facilitating agent,
which can include surface active agents, such as immune-stimulating complexes
(1SCOMS),
Freunds incomplete adjuvant, LPS analog including monophosphoryl lipid A,
muramyl
peptides, quinone analogs, vesicles such as squalene and squalene, hyaluronic
acid, lipids,
liposomes, calcium ions, viral proteins, polyanions, polycations, or
nanoparticles, or other
known transfection facilitating agents.
[0155] The transfection facilitating agent may be a polyanion, polycation,
including poly-
L-glutamate (LGS), or lipid. The transfection facilitating agent is poly-L-
glutamate, and the
poly-L-glutamate may be present in the immunogenic composition at a
concentration less
than 6 mg/ml. The transfection facilitating agent may also include surface
active agents such
as immune-stimulating complexes (ISCOMS), Freunds incomplete adjuvant, LPS
analog
including monophosphoryl lipid A, muramyl peptides, quinone analogs and
vesicles such as
squalene and squalene, and hyaluronic acid may also be used administered in
conjunction
with the genetic construct. The DNA plasmid immunogenic compositions may also
include a
transfection facilitating agent such as lipids, liposomes, including lecithin
liposomes or other
liposomes known in the art, as a DNA-liposome mixture (see for example
W09324640),
calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or
other known
transfection facilitating agents. The transfection facilitating agent is a
polyanion, polycation,
including poly-L-glutamate (LGS), or lipid. Concentration of the transfection
agent in the
immunogenic composition is less than 4 mg/ml, less than 2 mg/ml, less than 1
mg/ml, less
- 36 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
than 0.750 mg/ml, less than 0.500 mg/ml, less than 0.250 mg/ml, less than
0.100 mg/ml, less
than 0.050 mg/ml, or less than 0.010 mg/ml.
[0156] The pharmaceutically acceptable excipient can be an adjuvant. The
adjuvant can be
other genes that are expressed in an alternative plasmid or are delivered as
proteins in
combination with the plasmid above in the immunogenic composition. The
adjuvant may be
selected from the group consisting of: a-interferon(IFN-a), I3-interferon (IFN-
I3), y-interferon,
platelet derived growth factor (PDGF), TNFa, TNFP, GM-CSF, epidermal growth
factor
(EGF), cutaneous T cell-attracting chemokine (CTACK), epithelial thymus-
expressed
chemokine (TECK), mucosae-associated epithelial chemokine (MEC), IL-12, IL-15,
MHC,
CD80, CD86 including IL-15 having the signal sequence deleted and optionally
including the
signal peptide from IgE. The adjuvant can be IL-12, IL-15, IL-28, CTACK, TECK,
platelet
derived growth factor (PDGF), TNFa, TNFI3, GM-CSF, epidermal growth factor
(EGF), IL-
1, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL-18, or a combination thereof
[0157] Other genes that can be useful as adjuvants include those encoding: MCP-
1, M1P-
la, MIP-1p, 1L-8, RANTES, L-selectin, P-selectin, E-selectin, CD34, GlyCAM-1,
MadCAM-
1, LFA-1, VLA-1, Mac-1, p150.95, PECAM, 1CAM-1, 1CAM-2, 1CAM-3, CD2, LFA-3, M-
CSF, G-CSF, IL-4, mutant forms of IL-18, CD40, CD4OL, vascular growth factor,
fibroblast
growth factor, IL-7, IL-22, nerve growth factor, vascular endothelial growth
factor, Fas, TNF
receptor, Flt, Apo-1, p55, WSL-1, DR3, TRAMP, Apo-3, AIR, LARD, NGRF, DR4,
DRS,
KILLER, TRAIL-R2, TRICK2, DR6, Caspase ICE, Fos, c-jun, Sp-1. Ap-1, Ap-2, p38,
p65Rel, MyD88, IRAK, TRAF6, IkB, Inactive NIK, SAP K, SAP-1, JNK, interferon
response genes, NFkB, Bax, TRAIL, TRAILrec, TRAILrecDRCS, TRAIL-R3, TRAIL-R4,
RANK, RANK LIGAND, 0x40, 0x40 LIGAND, NKG2D, MICA, MICB, NKG2A,
NKG2B, NKG2C, NKG2E, NKG2F, TAP1, TAP2 and functional fragments thereof.
[0158] The immunogenic composition may further comprise a genetic vaccine
facilitator
agent as described in U.S. Serial No. 021,579 filed April 1, 1994, which is
fully incorporated
by reference.
[0159] The immunogenic composition can be formulated according to the mode of
administration to be used. According to some embodiments, the immunogenic
composition is
formulated in a buffer, optionally saline-sodium citrate buffer. For example,
the
immunogenic composition may formulated at a concentration of 10 mg nucleic
acid molecule
per milliliter of a sodium salt citrate buffer. An injectable immunogenic
pharmaceutical
composition can be sterile, pyrogen free and particulate free. An isotonic
formulation or
solution can be used. Additives for isotonicity can include sodium chloride,
dextrose,
- 37 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
mannitol, sorbitol, and lactose. The immunogenic composition can comprise a
vasoconstriction agent. The isotonic solutions can include phosphate buffered
saline.
Immunogenic compositions can further comprise stabilizers including gelatin
and albumin.
The stabilizers can allow the formulation to be stable at room or ambient
temperature for
extended periods of time, including LGS or polycations or polyanions.
[0160] Also provided herein are articles of manufacture comprising the
immunogenic
composition. In some embodiments, the article of manufacture is a container
holding the
immunogenic composition. The container may be, for example but not limited to,
a syringe or
a vial. The vial may have a stopper piercable by a syringe.
[0161] The immunogenic composition can be packaged in suitably sterilized
containers
such as ampules, bottles, or vials, either in multi-dose or in unit dosage
forms. The containers
are preferably hermetically sealed after being filled with a vaccine
preparation. Preferably,
the vaccines are packaged in a container having a label affixed thereto, which
label identifies
the vaccine, and bears a notice in a form prescribed by a government agency
such as the
United States Food and Drug Administration reflecting approval of the vaccine
under
appropriate laws, dosage information, and the like. The label preferably
contains information
about the vaccine that is useful to a health care professional administering
the vaccine to a
patient. The package also preferably contains printed informational materials
relating to the
administration of the vaccine, instructions, indications, and any necessary
required warnings.
[0162] Methods of Vaccination
[0163] Also provided herein are methods of treating, protecting against,
and/or preventing
disease in a subject in need thereof by administering the immunogenic
composition to the
subject. Administration of the immunogenic composition to the subject can
induce or elicit an
immune response in the subject. The induced immune response can be used to
treat, prevent,
and/or protect against disease, for example, pathologies relating to SARS-CoV-
2 infection.
The induced immune response in the subject administered the immunogenic
composition can
provide resistance to one or more SARS-CoV-2 strains.
[0164] The induced immune response can include an induced humoral immune
response
and/or an induced cellular immune response. The humoral immune response can be
induced
by about 1.5-fold to about 16-fold, about 2-fold to about 12-fold, or about 3-
fold to about 10-
fold. The induced humoral immune response can include IgG antibodies and/or
neutralizing
antibodies that are reactive to the antigen. The induced cellular immune
response can include
- 38 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
a CD8+ T cell response, which is induced by about 2-fold to about 30-fold,
about 3-fold to
about 25-fold, or about 4-fold to about 20-fold.
[0165] The vaccine dose can be between 1 pg to 10 mg active component/kg body
weight/time, and can be 20 pg to 10 mg component/kg body weight/time. The
vaccine can be
administered every 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35,
36, 37, 38, 39, 40
or more days or every 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
19, 20 or more
weeks. The number of vaccine doses for effective treatment can be 1, 2, 3, 4,
5, 6, 7, 8, 9, 10,
or more.
[0166] In one embodiment, the total vaccine dose is 1.0 mg of nucleic acid. In
one
embodiment, the total vaccine dose is 2.0 mg of nucleic acid, administered as
2x1.0mg
nucleic acid.
101671 a. Administration
[0168] The immunogenic composition can be formulated in accordance with
standard
techniques well known to those skilled in the pharmaceutical art. Such
compositions can he
administered in dosages and by techniques well known to those skilled in the
medical arts
taking into consideration such factors as the age, sex, weight, and condition
of the particular
subject, and the route of administration. The vaccine may be administered, for
example, in
one, two, three, four, or more injections. In some embodiments, an initial
dose of about 0.5
mg to about 2.0 mg of the nucleic acid molecule is administered to the
subject. The initial
dose may be administered in one, two, three, or more injections. The initial
dose may be
followed by administration of one, two, three, four, or more subsequent doses
of about 0.5
mg to about 2.0 mg of the nucleic acid molecule about one, two, three, four,
five, six, seven,
eight, ten, twelve or more weeks after the immediately prior dose. Each
subsequent dose may
be administered in one, two, three, or more injections. In some embodiments,
the
immunogenic composition is administered to the subject before, with, or after
the additional
agent. In some embodiments, the immunogenic composition is administered as a
booster
following administration of an agent for the treatment of SARS-CoV-2 infection
or the
treatment or prevention of a disease or disorder associated with SARS-CoV-2
infection. In
one embodiment, the disease or disorder associated with SARS-CoV-2 infection
includes, but
is not limited to, to Coronavirus Disease 2019 (COVID-19). In some
embodiments, the
disease or disorder associated with SARS-CoV-2 infection is Multisystem
inflammatory
syndrome in adults (MIS-A) or Multisystem inflammatory syndrome in children
(MIS-C).
- 39 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0169] The subject can be a mammal, such as a human, a horse, a nonhuman
primate, a
cow, a pig, a sheep, a cat, a dog, a guinea pig, a rabbit, a rat, or a mouse.
[0170] The vaccine can be administered prophylactically or therapeutically. In
prophylactic
administration, the vaccines can be administered in an amount sufficient to
induce an immune
response. In therapeutic applications, the vaccines are administered to a
subject in need
thereof in an amount sufficient to elicit a therapeutic effect. An amount
adequate to
accomplish this is defined as "therapeutically effective dose.- Amounts
effective for this use
will depend on, e.g., the particular composition of the vaccine regimen
administered, the
manner of administration, the stage and severity of the disease, the general
state of health of
the patient, and the judgment of the prescribing physician.
[0171] The vaccine can be administered by methods well known in the art as
described in
Donnelly et al. (Ann. Rev. In-imunol. 15:617-648 (1997)); Feigner et al. (U.S.
Pat. No.
5,580,859, issued Dec. 3, 1996); Feigner (U.S. Pat. No. 5,703,055, issued Dec.
30, 1997); and
Carson et al. (U.S. Pat. No. 5,679,647, issued Oct. 21, 1997), the contents of
all of which are
incorporated herein by reference in their entirety. The DNA of the vaccine can
he complexed
to particles or beads that can be administered to an individual, for example,
using a vaccine
gun. One skilled in the art would know that the choice of a pharmaceutically
acceptable
carrier, including a physiologically acceptable compound, depends, for
example, on the route
of administration of the expression vector.
[0172] The vaccine can be delivered via a variety of routes. Typical delivery
routes include
parenteral administration, e.g., intradermal, intramuscular or subcutaneous
delivery. Other
routes include oral administration, intranasal, and intravaginal routes. For
the DNA of the
vaccine in particular, the vaccine can be delivered to the interstitial spaces
of tissues of an
individual (Felgner et al., U.S. Pat. Nos. 5,580,859 and 5,703,055, the
contents of all of
which are incorporated herein by reference in their entirety). The vaccine can
also be
administered to muscle, or can be administered via intradermal or subcutaneous
injections, or
transdermally, such as by iontophoresis. Epidermal administration of the
vaccine can also be
employed. Epidermal administration can involve mechanically or chemically
irritating the
outermost layer of epidermis to stimulate an immune response to the irritant
(Carson et al.,
U.S. Pat. No. 5,679,647, the contents of which are incorporated herein by
reference in its
entirety). Parenteral administration may optionally be followed with
electroporation as
described herein.
[0173] The vaccine can also be formulated for administration via the nasal
passages.
Formulations suitable for nasal administration, wherein the carrier is a
solid, can include a
- 40 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
coarse powder having a particle size, for example, in the range of about 10 to
about 500
microns which is administered in the manner in which snuff is taken, i.e., by
rapid inhalation
through the nasal passage from a container of the powder held close up to the
nose. The
formulation can be a nasal spray, nasal drops, or by aerosol administration by
nebulizer. The
formulation can include aqueous or oily solutions of the vaccine.
[0174] The vaccine can be a liquid preparation such as a suspension, syrup or
elixir. The
vaccine can also be a preparation for parenteral, subcutaneous, intradermal,
intramuscular or
intravenous administration (e.g., injectable administration), such as a
sterile suspension or
emulsion.
[0175] The vaccine can be incorporated into liposomes, microspheres or other
polymer
matrices (Felgner et al., U.S. Pat. No. 5,703,055; Gregoriadis, Liposome
Technology, Vols. I
to III (2nd ed. 1993), the contents of which are incorporated herein by
reference in their
entirety). Liposomes can consist of phospholipids or other lipids, and can be
nontoxic,
physiologically acceptable and metabolizable carriers that are relatively
simple to make and
administer.
[0176] The vaccine can be administered via electroporation, such as by a
method described
in U.S. Pat. No. 7,664,545, the contents of which are incorporated herein by
reference. The
electroporation can be by a method and/or apparatus described in U.S. Pat.
Nos. 6,302,874;
5,676,646; 6,241,701; 6,233,482; 6,216,034; 6,208,893; 6,192,270; 6,181,964;
6,150,148;
6,120,493; 6,096,020; 6,068.650; and 5,702,359, the contents of which are
incorporated
herein by reference in their entirety. The electroporation may be carried out
via a minimally
invasive device.
[0177] The minimally invasive electroporation device ("MID") may be an
apparatus for
injecting the vaccine described above and associated fluid into body tissue.
The device may
comprise a hollow needle, DNA cassette, and fluid delivery means. wherein the
device is
adapted to actuate the fluid delivery means in use so as to concurrently (for
example,
automatically) inject DNA into body tissue during insertion of the needle into
the said body
tissue. This has the advantage that the ability to inject the DNA and
associated fluid gradually
while the needle is being inserted leads to a more even distribution of the
fluid through the
body tissue. The pain experienced during injection may be reduced due to the
distribution of
the DNA being injected over a larger area.
[0178] The MID may inject the vaccine into tissue without the use of a needle.
The MID
may inject the vaccine as a small stream or jet with such force that the
vaccine pierces the
surface of the tissue and enters the underlying tissue and/or muscle. The
force behind the
- 41 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
small stream or jet may be provided by expansion of a compressed gas, such as
carbon
dioxide through a micro-orifice within a fraction of a second. Examples of
minimally
invasive electroporation devices, and methods of using them, are described in
published U.S.
Patent Application No. 20080234655; U.S. Pat. Nos. 6,520,950; 7,171,264;
6,208,893;
6,009,347; 6,120,493; 7,245,963; 7,328,064; and 6,763,264, the contents of
each of which are
herein incorporated by reference.
101791 The MID may comprise an injector that creates a high-speed jet of
liquid that
painlessly pierces the tissue. Such needle-free injectors are commercially
available. Examples
of needle-free injectors that can be utilized herein include those described
in U.S. Pat. Nos.
3,805,783; 4,447,223; 5,505,697; and 4,342,310, the contents of each of which
are herein
incorporated by reference.
[0180] A desired vaccine in a form suitable for direct or indirect
electrotransport may be
introduced (e.g., injected) using a needle-free injector into the tissue to be
treated, usually by
contacting the tissue surface with the injector so as to actuate delivery of a
jet of the agent,
with sufficient force to cause penetration of the vaccine into the tissue. For
example, if the
tissue to be treated is mucosa, skin or muscle, the agent is projected towards
the mucosal or
skin surface with sufficient force to cause the agent to penetrate through the
stratum corneum
and into dermal layers, or into underlying tissue and muscle, respectively.
[0181] Needle-free injectors are well suited to deliver vaccines to all types
of tissues,
particularly to skin and mucosa. In some embodiments, a needle-free injector
may be used to
propel a liquid that contains the vaccine to the surface and into the
subject's skin or mucosa.
Representative examples of the various types of tissues that can be treated
using the invention
methods include pancreas, larynx, nasopharynx, hypopharynx, oropharynx, lip,
throat, lung,
heart, kidney, muscle, breast, colon, prostate, thymus, testis, skin, mucosal
tissue, ovary,
blood vessels, or any combination thereof
101821 The MID may have needle electrodes that electroporate the tissue. By
pulsing
between multiple pairs of electrodes in a multiple electrode array, for
example set up in
rectangular or square patterns, provides improved results over that of pulsing
between a pair
of electrodes. Disclosed, for example, in U.S. Pat. No. 5,702,359 entitled -
Needle Electrodes
for Mediated Delivery of Drugs and Genes- is an array of needles wherein a
plurality of pairs
of needles may be pulsed during the therapeutic treatment. In that
application, which is
incorporated herein by reference as though fully set forth, needles were
disposed in a circular
array, but have connectors and switching apparatus enabling a pulsing between
opposing
pairs of needle electrodes. A pair of needle electrodes for delivering
recombinant expression
- 42 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
vectors to cells may be used. Such a device and system is described in U.S.
Pat. No.
6,763,264, the contents of which are herein incorporated by reference.
Alternatively, a single
needle device may be used that allows injection of the DNA and electroporation
with a single
needle resembling a normal injection needle and applies pulses of lower
voltage than those
delivered by presently used devices, thus reducing the electrical sensation
experienced by the
patient.
[0183] The MID may comprise one or more electrode arrays. The arrays may
comprise two
or more needles of the same diameter or different diameters. The needles may
be evenly or
unevenly spaced apart. The needles may be between 0.005 inches and 0.03
inches, between
0.01 inches and 0.025 inches; or between 0.015 inches and 0.020 inches. The
needle may be
0.0175 inches in diameter. The needles may be 0.5 mm, 1.0 mm, 1.5 mm, 2.0 mm,
2.5 mm,
3.0 mm, 3.5 mm, 4.0 mm, or more spaced apart.
101841 The MID may consist of a pulse generator and a two or more-needle
vaccine
injectors that deliver the vaccine and electroporation pulses in a single
step. The pulse
generator may allow for flexible programming of pulse and injection parameters
via a flash
card operated personal computer, as well as comprehensive recording and
storage of
electroporation and patient data. The pulse generator may deliver a variety of
volt pulses
during short periods of time. For example, the pulse generator may deliver
three 15 volt
pulses of 100 ms in duration. An example of such a MID is the Elgen 1000
system by Inovio
Biomedical Corporation, which is described in U.S. Pat. No. 7,328.064, the
contents of which
are herein incorporated by reference.
[0185] The MID may be a CELLECTRAk (Inovio Pharmaceuticals, Blue Bell Pa.)
device
and system, which is a modular electrode system, that facilitates the
introduction of a
macromolecule, such as a DNA, into cells of a selected tissue in a body or
plant. The modular
electrode system may comprise a plurality of needle electrodes; a hypodermic
needle: an
electrical connector that provides a conductive link from a programmable
constant-current
pulse controller to the plurality of needle electrodes; and a power source. An
operator can
grasp the plurality of needle electrodes that are mounted on a support
structure and firmly
insert them into the selected tissue in a body or plant. The macromolecules
are then delivered
via the hypodermic needle into the selected tissue. The programmable constant-
current pulse
controller is activated and constant-current electrical pulse is applied to
the plurality of needle
electrodes. The applied constant-current electrical pulse facilitates the
introduction of the
macromolecule into the cell between the plurality of electrodes. Cell death
due to overheating
of cells is minimized by limiting the power dissipation in the tissue by
virtue of constant-
- 43 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
current pulses. The Cellectra device and system is described in U.S. Pat. No.
7,245,963, the
contents of which are herein incorporated by reference. The CELLECTRA device
may be
the CELLECTRA 2000 device or CELLECTRA 3PSP device.
[0186] The MID may be an Elgen 1000 system (Inovio Pharmaceuticals). The Elgen
1000
system may comprise device that provides a hollow needle; and fluid delivery
means,
wherein the apparatus is adapted to actuate the fluid delivery means in use so
as to
concurrently (for example automatically) inject fluid, the described vaccine
herein, into body
tissue during insertion of the needle into the said body tissue. The advantage
is the ability to
inject the fluid gradually while the needle is being inserted leads to a more
even distribution
of the fluid through the body tissue. It is also believed that the pain
experienced during
injection is reduced due to the distribution of the volume of fluid being
injected over a larger
area.
101871 In addition, the automatic injection of fluid facilitates automatic
monitoring and
registration of an actual dose of fluid injected. This data can be stored by a
control unit for
documentation purposes if desired.
[0188] It will be appreciated that the rate of injection could be either
linear or non-linear
and that the injection may be carried out after the needles have been inserted
through the skin
of the subject to be treated and while they are inserted further into the body
tissue.
[0189] Suitable tissues into which fluid may be injected by the apparatus of
the present
invention include tumor tissue, skin or liver tissue but may be muscle tissue.
[0190] The apparatus further comprises needle insertion means for guiding
insertion of the
needle into the body tissue. The rate of fluid injection is controlled by the
rate of needle
insertion. This has the advantage that both the needle insertion and injection
of fluid can be
controlled such that the rate of insertion can be matched to the rate of
injection as desired. It
also makes the apparatus easier for a user to operate. If desired means for
automatically
inserting the needle into body tissue could be provided.
[0191] A user could choose when to commence injection of fluid. Ideally
however,
injection is commenced when the tip of the needle has reached muscle tissue
and the
apparatus may include means for sensing when the needle has been inserted to a
sufficient
depth for injection of the fluid to commence. This means that injection of
fluid can be
prompted to commence automatically when the needle has reached a desired depth
(which
will nonnally be the depth at which muscle tissue begins). The depth at which
muscle tissue
begins could for example be taken to be a preset needle insertion depth such
as a value of 4
mm which would be deemed sufficient for the needle to get through the skin
layer.
- 44 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0192] The sensing means may comprise an ultrasound probe. The sensing means
may
comprise a means for sensing a change in impedance or resistance. In this
case, the means
may not as such record the depth of the needle in the body tissue but will
rather be adapted to
sense a change in impedance or resistance as the needle moves from a different
type of body
tissue into muscle. Either of these alternatives provides a relatively
accurate and simple to
operate means of sensing that injection may commence. The depth of insertion
of the needle
can further be recorded if desired and could be used to control injection of
fluid such that the
volume of fluid to be injected is determined as the depth of needle insertion
is being
recorded.
[0193] The apparatus may further comprise: a base for supporting the needle;
and a housing
for receiving the base therein, wherein the base is moveable relative to the
housing such that
the needle is retracted within the housing when the base is in a first
rearward position relative
to the housing and the needle extends out of the housing when the base is in a
second forward
position within the housing. This is advantageous for a user as the housing
can be lined up on
the skin of a patient, and the needles can then be inserted into the patient's
skin by moving the
housing relative to the base.
[0194] As stated above, it is desirable to achieve a controlled rate of fluid
injection such
that the fluid is evenly distributed over the length of the needle as it is
inserted into the skin.
The fluid delivery means may comprise piston driving means adapted to inject
fluid at a
controlled rate. The piston driving means could for example be activated by a
servo motor.
However, the piston driving means may be actuated by the base being moved in
the axial
direction relative to the housing. It will be appreciated that alternative
means for fluid
delivery could be provided. Thus, for example, a closed container which can be
squeezed for
fluid delivery at a controlled or non-controlled rate could be provided in the
place of a
syringe and piston system.
101951 The apparatus described above could be used for any type of injection.
It is however
envisaged to be particularly useful in the field of electroporation and so it
may further
comprises means for applying a voltage to the needle. This allows the needle
to be used not
only for injection but also as an electrode during, electroporation. This is
particularly
advantageous as it means that the electric field is applied to the same area
as the injected
fluid. There has traditionally been a problem with electroporation in that it
is very difficult to
accurately align an electrode with previously injected fluid and so users have
tended to inject
a larger volume of fluid than is required over a larger area and to apply an
electric field over a
higher area to attempt to guarantee an overlap between the injected substance
and the electric
- 45 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
field. Using the present invention, both the volume of fluid injected and the
size of electric
field applied may be reduced while achieving a good fit between the electric
field and the
fluid.
[0196] Use in Combination
[0197] In some embodiments, the present invention provides a method of
treating SARS-
CoV-2 infection, or treating, protecting against, and/or preventing a disease
or disorder
associated with SARS-CoV-2 infection in a subject in need thereof by
administering a
combination of a nucleic acid molecule encoding a SARS-CoV-2 antigen, or
fragment or
variant thereof in combination with one or more additional agents for the
treatment of SARS-
CoV-2 infection or the treatment or prevention of disease or disorder
associated with SARS-
CoV-2 infection. In some embodiments, the disease or disorder associated with
SARS-CoV-2
infection is Coronavirus Disease 2019 (COV1D-19), Multisystem inflammatory
syndrome in
adults (MIS-A), or Multisystem inflammatory syndrome in children (MIS-C).
[0198] The nucleic acid molecule encoding a SARS-CoV-2 antigen and additional
agent
may be administered using any suitable method such that a combination of the
nucleic acid
molecule encoding a SARS-CoV-2 antigen and the additional agent are both
present in the
subject. In one embodiment, the method may comprise administration of a first
composition
comprising an agent for the treatment of SARS-CoV-2 infection or the treatment
or
prevention of disease or disorder associated with SARS-CoV-2 infection and
administration
of a second composition comprising a nucleic acid molecule encoding a SARS-CoV-
2
antigen less than 1, less than 2, less than 3, less than 4, less than 5, less
than 6, less than 7,
less than 8, less than 9 or less than 10 days following administration of the
first composition
comprising the agent for the treatment of SARS-CoV-2 infection or the
treatment or
prevention of disease or disorder associated with SARS-CoV-2 infection. In one
embodiment, the method may comprise administration of a first composition
comprising a
nucleic acid molecule encoding a SARS-CoV-2 antigen and administration of a
second
composition comprising an agent for the treatment of SARS-CoV-2 infection or
the treatment
or prevention of disease or disorder associated with SARS-CoV-2 infection less
than 1, less
than 2, less than 3, less than 4, less than 5, less than 6, less than 7, less
than 8, less than 9 or
less than 10 days following administration of the nucleic acid molecule
encoding a SARS-
CoV-2 antigen. In one embodiment, the method may comprise administration of a
first
composition comprising an agent for the treatment of SARS-CoV-2 infection or
the treatment
- 46 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
or prevention of disease or disorder associated with SARS-CoV-2 infection and
a second
composition comprising a nucleic acid molecule encoding a SARS-CoV-2 antigen
concurrently. In one embodiment, the method may comprise administration of a
single
composition comprising an agent for the treatment of SARS-CoV-2 infection or
the treatment
or prevention of disease or disorder associated with SARS-CoV-2 infection and
a nucleic
acid molecule encoding a SARS-CoV-2 antigen.
[0199] In some embodiments, the agent for the treatment of SARS-CoV-2
infection or the
treatment or prevention of disease or disorder associated with SARS-CoV-2
infection is a
therapeutic agent. In one embodiment, the therapeutic agent is an antiviral
agent. In one
embodiment, the therapeutic agent is an antibiotic agent.
[0200] Non-limiting examples of antibiotics that can be used in combination
with the a
nucleic acid molecule encoding a SARS-CoV-2 antigen of the invention include
aminoglycosides (e.g., gentamicin, amikacin, tobramycin), quinolones (e.g.,
ciprofloxacin,
levofloxacin), cephalosporins (e.g., ceftazidime, cefepime, cefoperazone,
cefpirome,
ceftobiprole), antipseudomonal penicillins: carboxypenicillins (e.g.,
carbenicillin and
ticarcillin) and ureidopenicillins (e.g., mezlocillin, azlocillin, and
piperacillin), carbapenems
(e.g., meropenem, imipenem, doripenem), polymyxins (e.g., polymyxin B and
colistin) and
monobactams (e.g., aztreonam).
[0201] Administration as a booster
[0202] In one embodiment, the immunogenic composition is administered as a
booster
vaccine following administration of an initial agent or vaccine for the
treatment of SARS-
CoV-2 infection or the treatment or prevention of a disease or disorder
associated with
SARS-CoV-2 infection, including, but not limited to COVID-19, Multisystem
inflammatory
syndrome in adults (MIS-A), or Multisystem inflammatory syndrome in children
(MIS-C). In
one embodiment, the booster vaccine is administered at least once, at least
twice, at least 3
times, at least 4 times, or at least 5 times following administration of an
initial agent or
vaccine for the treatment of SARS-CoV-2 infection or the treatment or
prevention of a
disease or disorder associated with SARS-CoV-2 infection, including, but not
limited to
COVID-19, Multisystem inflammatory syndrome in adults (MIS-A), or Multisystem
inflammatory syndrome in children (MIS-C). In one embodiment, the booster
vaccine is
administered at least 8 hours, at least 12 hours, at least 16 hours, at least
20 hours, at least 24
hours, at least 36 hours, at least 48 hours, at least 60 hours, at least 72
hours, at least 4 days,
at least 5 days, at least 6 days, at least 1 week at least 2 weeks, at least 3
weeks, at least 4
- 47 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
weeks, at least 1 month, at least 2 months, at least 3 months, at least 4
months, at least 5
months, at least 6 months, at least 7 months, at least 8 months, at least 9
months, at least 10
months, at least 11 months, at least 1 year or greater than 1 year following
administration of
an initial agent or vaccine for the treatment of SARS-CoV-2 infection or the
treatment or
prevention of a disease or disorder associated with SARS-CoV-2 infection,
including, but not
limited to COVID-19, Multisystem inflammatory syndrome in adults (MIS-A), or
Multisystem inflammatory syndrome in children (MIS-C).
[0203] Use in assays
[0204] In some embodiments, the nucleic acid molecules, or encoded antigens,
of the
invention can be used in assays in vivo or in vitro. In some embodiments, the
nucleic acid
molecules, or encoded antigens can be used in assays for detecting the
presence of anti-
SARS-CoV-2 spike antibodies. Exemplary assays in which the nucleic acid
molecules or
encoded antigens can be incorporated into include, but are not limited to,
Western blot, dot
blot, surface plasmon resonance methods, Flow Cytometry methods, various
immunoassays,
for example, immunohistochemistry assays, immunocytochemistry assays. EL1SA,
capture
ELISA, enzyme-linked immunospot (ELISpot) assays, sandwich assays, enzyme
immunoassay, radioimmunoassay, fluorescent immunoassay, and the like, all of
which are
known to those of skill in the art. See e.g. Harlow et al., 1988, Antibodies:
A Laboratory
Manual, Cold Spring Harbor, New York; Harlow et al., 1999, Using Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, NY.
[0205] In one embodiment, the SARS-CoV-2 spike antigen, or fragments thereof,
of the
invention can be used in an assay for intracellular cytokine staining combined
with flow
cytometry, to assess T-cell immune responses. This assay enables the
simultaneous
assessment of multiple phenotypic, differentiation and functional parameters
pertaining to
responding T-cells, most notably, the expression of multiple effector
cytokines. These
attributes make the technique particularly suitable for the assessment of T-
cell immune
responses induced by the vaccine of the invention.
[0206] In one embodiment, the SARS-CoV-2 spike antigen, or fragments thereof,
of the
invention can be used in an ELIspot assay. The ELISpot assay is a highly
sensitive
immunoassay that measures the frequency of cytokine-secreting cells at the
single-cell level.
In this assay, cells are cultured on a surface coated with a specific capture
antibody in the
presence or absence of stimuli. In one embodiment, the SARS-CoV-2 spike
antigen, or
fragments thereof, of the invention can be used as the stimulus in the ELISpot
assay.
- 48 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0207] Diagnostic Methods
[0208] In some embodiments, the invention relates to methods of diagnosing a
subject as
having SARS-CoV-2 infection or having SARS-CoV-2 antibodies. In some
embodiments, the
methods include contacting a sample from a subject with a SARS-CoV-2 antigen
of the
invention, or a cell comprising a nucleic acid molecule for expression of the
SARS-CoV-2
antigen, and detecting binding of an anti-SARS-CoV-2 spike antibody to the
SARS-CoV-2
antigen of the invention. In such an embodiment, binding of an anti-SARS-CoV-2
spike
antibody present in the sample of the subject to the antigen, or fragment
thereof, of the
invention would indicate that the subject is currently infected or was
previously infected with
SARS-CoV-2.
102091 Kits and Articles of Manufacture
[0210] Provided herein is a kit, which can be used for treating a subject
using the method of
vaccination described above. The kit can comprise the immunogenic composition
described
herein.
[0211] The kit can also comprise instructions for carrying out the vaccination
method
described above and/or how to use the kit. Instructions included in the kit
can be affixed to
packaging material or can be included as a package insert. While instructions
are typically
written or printed materials, they are not limited to such. Any medium capable
of storing
instructions and communicating them to an end user is contemplated by this
disclosure. Such
media include, but are not limited to, electronic storage media (e.g.,
magnetic discs, tapes,
cartridges), optical media (e.g., CD ROM), and the like. As used herein, the
term
"instructions" can include the address of an intemet site which provides
instructions.
[0212] Further provided herein are articles of manufacture containing the
immunogenic
composition described herein. In some embodiments, the article of manufacture
is a
container, such as a vial, optionally a single-use vial. In one embodiment,
the article of
manufacture is a single-use glass vial equipped with a stopper, which contains
the
immunogenic composition described herein to be administered. In some
embodiments, the
vial comprises a stopper, pierceable by a syringe, and a seal. In some
embodiments, the
article of manufacture is a syringe.
[0213] The present invention has multiple aspects, illustrated by the
following non-limiting
examples.
- 49 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0214] EXAMPLES
[0215] Example 1
[0216] Materials & Methods:
[0217] Cell lines. Human embryonic kidney (HEK)-293T (ATCC CRL3216TM) and
African green monkey kidney COS-7 (ATCC CRL-1651Tm) cell lines were obtained
from
ATCC (Old Town Manassas, VA). All cell lines were maintained in DMEM
supplemented
with 10% fetal bovine serum (FBS) and penicillin-streptomycin.
[0218] In vitro protein expression (Western blot). Human embryonic kidney
cells, 293T
were cultured and transfected as described previously (Yan, et al. Enhanced
cellular immune
responses elicited by an engineered HIV-1 subtype B consensus-based envelope
DNA
vaccine. Mol Ther. 2007;15(2):411-421.). 293T cells were transfected with pDNA
using
TurboFectin8.0 (OriGene) transfection reagent following the manufacturer's
protocol. Forty-
eight hours later, cell lysates were harvested using modified RIPA cell lysis
buffer. Proteins
were separated on a 4-12% BIS-TRIS gel (ThermoFisher Scientific). Following
transfer,
blots were incubated with an anti-SARS-CoV spike protein polyclonal antibody
(Novus
Biologicals), and then visualized with horseradish peroxidase (HRP)-conjugated
anti-mouse
IgG (GE Amersham).
[0219] Immunofluorescence of transfected 293T cells. For in vitro staining of
Spike protein
expression, 293T cells were cultured on 4-well glass slides (Lab-Tek) and
transfected with 3
[tg/well of pDNA using TurboFectin8.0 (OriGene) transfection reagent following
the
manufacturer's protocol. Cells were fixed 48hrs after transfection with 10%
Neutral-buffered
Formalin (BBC Biochemical, Washington State) for 10 min at room temperature
(RT) and
then washed with PBS. Before staining, chamber slides were blocked with 0.3%
(v/v) Triton-
X (Sigma), 2% (v/v) donkey serum in PBS for lhr at RT. Cells were stained with
a rabbit
anti-SARS-CoV spike protein polyclonal antibody (Novus Biologicals) diluted in
1% (w/v)
BSA (Sigma), 2% (v/v) donkey serum, 0.3% (v/v) Triton-X (Sigma) and 0.025%
(v/v) 1g/m1
Sodium Azide (Sigma) in PBS for 2hrs at RT. Slides were washed three times for
5 min in
PBS and then stained with donkey anti-rabbit IgG AF488 (Life Technologies,
A21206) for
lhr at RT. Slides were washed again and mounted and covered with DAPI-
Fluoromount
(SouthernBiotech).
[0220] In vitro RNA expression (qRT-PCR). In vitro mRNA expression of the
plasmid was
demonstrated by transfection of COS-7 with serially diluted plasmids followed
by analysis of
the total RNA extracted from the cells using reverse transcription and PCR.
Transfections of
- 50 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
four concentrations of the plasmid were performed using FuGENE 6 transfection
reagent
(Promega) which resulted in final masses ranging between 80 and 10 ng/well.
The
transfections were performed in duplicate. Following 18 to 26 hours of
incubation, the cells
were lysed with RLT Buffer (Qiagen). Total RNA was isolated from each well
using the
Qiagen RNeasy kit following the kit instructions. The resulting RNA
concentration was
determined by OD260/280, and samples of the RNA were diluted to 10 ng/vtL. One
hundred
nanograms of RNA was then converted to cDNA using the High Capacity cDNA
Reverse
Transcription (RT) kit (Applied Biosystems) following the kit instructions. RT
reactions
containing RNA but no reverse transcriptase (minus RT) were included as
controls for
plasmid DNA or cellular genomic DNA sample contamination. Eight 1.11_, of
sample cDNA
were then subjected to PCR using primers and probes that are specific to the
target sequence
(pGX9501 Forward ¨ CAGGACAAGAACACACAGGAA (SEQ ID NO: 7); pGX950I
Reverse ¨ CAGGCAGGATTTGGGAGAAA (SEQ ID NO: 8); pGX9501 Probe ¨
ACCCATCAAGGACTTTGGAGG (SEQ ID NO: 9); and pGX9503 Forward ¨
AGGACAAGAACACACAGGAAG (SEQ ID NO: 10); pGX9503 Reverse ¨
CAGGATCTGGGAGAAGTTGAAG (SEQ ID NO: 11); pGX9503 Probe ¨
ACACCACCCATCAAGGACTTTGGA (SEQ ID NO: 12)). In a separate reaction, the same
quantity of sample cDNA was subjected to PCR using primers and a probe
designed for
COS-7 cell line 13-actin sequences 03-actin Forward ¨ GTGACGTGGACATCCGTAAA
(SEQ ID NO: 13); (3-actin Reverse ¨ CAGGGCAGTAATCTCCTTCTG (SEQ ID NO: 14);
13-actin Probe ¨ TACCCTGGCATTGCTGACAGGATG (SEQ ID NO: 15)). The primers and
probes were synthesized by Integrated DNA Technologies, Inc. and the probes
were labeled
with 56-FAM and Black Hole Quencher 1. The reaction used ABI Fast Advance 2X
(Cat. No.
4444557), with final forward and reverse primer concentrations of 1 p.M and
probe
concentrations of 0.3 1.1.M. Using a QuantStudioTM 7 Flex Real Time PCR Studio
System
(Applied Biosystems), samples were first subjected to a hold of 1 minute at 95
C and then 40
cycles of PCR with each cycle consisting of 1 second at 95 C and 20 seconds at
60 C.
Following PCR, the amplifications results were analyzed as follows. The
negative
transfection controls (NTCs), the minus RT controls, and the NTC were
scrutinized for each
of their respective indications. The threshold cycle (CT) of each transfection
concentration
for the INO-4800 SARS-CoV-2 target mRNA and for the f3-actin mRNA was
generated from
the QuantStudioTM software using an automatic threshold setting. The plasmid
was
considered to be active for mRNA expression if the expression in any of the
plasmid-
transfected wells compared to the negative transfection controls were greater
than 5 CT.
- 51 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
Animals. Female, 6 week old C57/BL6 and BALB/c mice were purchased from
Charles
River Laboratories (Malvern, PA) and The Jackson Laboratory (Bar Harbor, ME).
Female, 8
week old Hartley guinea pigs were purchased from Elm Hill Labs (Chelmsford,
MA). All
animals were housed in the animal facility at The Wistar Institute Animal
Facility or Acculab
Life Sciences (San Diego, CA). All animal testing and research complied with
all relevant
ethical regulations and studies received ethical approval by the Wistar
Institute or Acculab
Institutional Animal Care and Use Committees (IACUC). For mouse studies, on
day 0, doses
of 2.5, 10 or 25 tg pDNA were administered to the tibialis anterior (TA)
muscle by needle
injection followed by CELLECTRA in vivo electroporation (EP). The CELLECTRA
EP
delivery consists of two sets of pulses with 0.2 Amp constant current. Second
pulse sets is
delayed 3 seconds. Within each set there are two 52 ms pulses with a 198 ms
delay between
the pulses. On days 0 and 14, blood was collected. Parallel groups of mice
were serially
sacrificed on days 4, 7, and 10 post-immunization for analysis of cellular
immune responses.
For guinea pig studies, on day 0, 100 mg pDNA was administered to the skin by
Mantoux
injection followed by CELLECTRA in vivo EP.
102211 Antigen binding EL1SA. EL1SAs were performed to determine sera antibody
binding titers. Nunc ELISA plates were coated with 1 ug/m1 recombinant protein
antigens in
Dulbecco's phosphate-buffered saline (DPBS) overnight at 4 C. Plates were
washed three
times, then blocked with 3% bovine serum albumin (BSA) in DPBS with 0.05%
Tween 20
for 2 hours at 37 C. Plates were then washed and incubated with serial
dilutions of mouse or
guinea pig sera and incubated for 2 hours at 37 C. Plates were again washed
and then
incubated with 1:10,000 dilution of horse radish peroxidase (HRP)-conjugated
anti-guinea
pig IgG secondary antibody (Sigma-Aldrich, cat. A7289) or HRP-conjugated anti-
mouse IgG
secondary antibody (Sigma-Aldrich) and incubated for 1 hour at RT. After final
wash, plates
were developed using SureBlueTM TMB 1-Component Peroxidase Substrate (KPL,
cat. 52-
00-03), and the reaction stopped with TMB Stop Solution (KPL, cat. 50-85-06).
Plates were
read at 450 nm wavelength within 30 minutes using a SynergyTM HTX plate reader
(BioTek
Instruments, Highland Park, VT). Binding antibody endpoint titers (EPTs) were
calculated as
previously described (Bagarazzi ML, Yan J, Morrow MP, et al. Immunotherapy
against
HPV16/18 generates potent TH1 and cytotoxic cellular immune responses. Sci
Transl Med.
2012;4(155):155ra138). Binding antigens tested included, SARS-CoV-2 antigens:
Si spike
protein (Sino Biological 40591-VO8H), S1+S2 ECD spike protein (Sino Biological
40589-
VO8B1), RBD (University of Texas, at Austin (McLellan Lab.)); SARS-COV
antigens: Spike
- 52 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
Si protein (Sino Biological 40150-VO8B1), S (1-1190) (Immune Tech IT-002-001P)
and
Spike C-terminal (Meridian Life Science R18572).
[0222] ACE2 Competition ELISA. For mouse studies, ELISAs were performed to
determine sera IgG antibody competition against human ACE2 with a human Fc
tag. Nunc
ELISA plates were coated with 1 ug/mL rabbit anti-His6X in 1X PBS for 4-6
hours at room
temperature (RT) and washed 4 times with washing buffer (1X PBS and 0.05%
Tweenk 20).
Plates were blocked overnight at 4 C with blocking buffer (1X PBS, 0.05%
Tweeng 20, 5%
evaporated milk and 1% FBS). Plates were washed four times with washing buffer
then
incubated with full length (S1+S2) spike protein containing a C-terminal His
tag (Sino
Biologics, cat. 40589-VO8B1) at 10 lag mL-1 for 1 hour at RT. Plates were
washed and then
serial dilutions of purified mouse IgG mixed with 0.1 ng mL-1 recombinant
human ACE2
with a human Fc tag (ACE2-IgHu) were incubated for 1-2 hours at RT. Plates
were again
washed and then incubated with 1:10,000 dilution of horse radish peroxidase
(HRP)
conjugated anti-human IgG secondary antibody (Bethyl, cat. A80-304P) and
incubated for 1
hour at RT. After final wash plates were developed using 1-Step Ultra TMB-
ELISA Substrate
(Thermo, cat. 34029) and the reaction stopped with I M Sulfuric Acid. Plates
were read at
450 nm wavelength within 30 minutes using a SpectraMax Plus 384 Microplate
Reader
(Molecular Devices, Sunnyvale, CA). Competition curves were plotted and the
area under the
curve (AUC) was calculated using Prism 8 analysis software with multiple t-
tests to
determine statistical significance.
[0223] For guinea pig studies, 96 well half area assay plates (Costar) were
coated with 25
pi per well of 5 ug/mL of SARS-CoV-2 spike S1+S2 protein (Sino Biological)
diluted in lx
DPBS (Thermofisher) overnight at 4 C. Plates were washed with 1xPBS buffer
with 0.05%
TWEEN 20 (Sigma). 100 pi per well of 3% (w/v) BSA (Sigma) in lx PBS with
0.05%
TWEEN 20 were added and incubated for 1 hr at 37 C. Serum samples were
diluted 1:20 in
1% (w/v) BSA in lx PBS with 0.05% TWEEN. After washing the assay plate, 25
pi/well of
diluted serum was added and incubated 1 hr at 37 C. Human recombinant ACE2-Fc-
tag
(Sinobiological) was added directly to the diluted serum, followed by 1 hr of
incubation at
37 C. Plates were washed and 25 pi per well of 1:10,000 diluted goat anti-hu
Fc fragment
antibody HRP (Bethyl, A80-304P) was added to the assay plate. Plates were
incubated 1 hr at
RT. For development the SureBlue/TMB Stop Solution (KPL, MD) was used and O.D.
was
recorded at 450 nm.
[0224] SARS-CoV-2 Pseudovirus neutralization assay. SARS-CoV-2 pseudotyped
viruses
were produced using HEK293T cells transfected with GeneJammer (Agilent) using
IgE-
- 53 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
SARS-CoV-2 S plasmid (Genscript) and pNL4-3.Luc.R-E- plasmid (NIH AIDS
reagent) at a
1:1 ratio. Forty-eight hours post transfection, transfection supernatant was
collected, enriched
with FBS to 12% final volume, steri-filtered (Millipore Sigma), and aliquoted
for storage at -
80 C. SARS-CoV-2 pseudotyped viruses were titered and yielded greater than 50
times the
relative luminescence units (RLU) to cells alone after 72h of infection. Mouse
sera from
INO-4800 vaccinated and naive groups were heat inactivated for 15 minutes at
56 C and
serially diluted three fold starting at a 1:10 dilution for assay. Sera were
incubated with a
fixed amount of SARS-CoV-2 pseudotyped virus for 90 minutes. HEK293T cells
stably
expressing ACE2 were added after 90 minutes and allowed to incubate in
standard incubator
(37% humidity, 5% CO2) for 72 hours. Post infection, cells were lysed using
briteliteTM plus
luminescence reporter gene assay system (Perkin Elmer Catalog no. 6066769) and
relative
luminescence units (RLU) were measured using the Biotek plate reader.
Neutralization titers
(ID5o) were calculated as the serum dilution at which RLU were reduced by 50%
compared to
RLU in virus control wells after subtraction of background RLU in cell control
wells.
[0225] SARS-CoV-2 wildtype virus neutralization assays. SARS-CoV-
2/Australia/VIC01/2020 isolate neutralization assays were performed at Public
Health
England (Porton Down, UK). Neutralizing virus titers were measured in serum
samples that
had been heat-inactivated at 56 C for 30 minutes. SARS-CoV-2
(Australia/VIC01/2020
isolate) (Caly et al., Isolation and rapid sharing of the 2019 novel
coronavirus (SARS-CoV-2)
from the first patient diagnosed with COVID-19 in Australia. Med. I Aust.
(2020) doi:
10.5694/naja2.50569; Published online: 13 April 2020) was diluted to a
concentration of 933
pfu/ml and mixed 50:50 in 1% FCS/MEM containing 25mM HEPES buffer with
doubling
serum dilutions from 1:10 to 1:320 in a 96-well V-bottomed plate. The plate
was incubated at
37 C in a humidified box for 1 hour before the virus was transferred into the
wells of a twice
DPBS-washed 24-well plate that had been seeded the previous day at 1.5 x 105
Vero E6 cells
per well in 10% FCS/MEM. Virus was allowed to adsorb at 37 C for a further
hour and
overlaid with plaque assay overlay media (1X MEM/1.5% CMC/4% FCS final). After
5 days
incubation at 37 C in a humidified box, the plates were fixed, stained and
plaques counted.
Median neutralizing titers (ND50) were determined using the Spearman-Karber
formula
relative to virus only control wells.
102261 SARS-CoV-2/WH-09/human/2020 isolate neutralization assays were
performed at
the Institute of Laboratory Animal Science, Chinese Academy of Medical
Sciences (CAMS)
approved by the National Health Commission of the People's Republic of China.
Seed
SARS-CoV-2 (SARS-CoV-2/WH-09/human/2020) stocks and virus isolation studies
were
- 54 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
performed in Vero E6 cells, which are maintained in Dulbecco's modified
Eagle's medium
(DMEM, Invitrogen, Carlsbad, USA) supplemented with 10% fetal bovine serum
(FBS), 100
'Um' penicillin, and 100 p.g/m1 streptomycin, and incubated at 36.5 C, 5% CO2.
Virus titer
were determined using a standard 50% tissue culture infection dose (TCID50)
assay. Serum
samples collected from immunized animals were inactivated at 56 C for 30
minutes and
serially diluted with cell culture medium in two-fold steps. The diluted
samples were mixed
with a virus suspension of 100 TCID50 in 96-well plates at a ratio of 1:1,
followed by 2 hours
incubation at 36.5 C in a 5% CO2 incubator. 1-2 >< 104 Vero cells were then
added to the
serum-virus mixture, and the plates were incubated for 3-5 days at 36.5 C in a
5% CO2
incubator. Cytopathic effect (CPE) of each well was recorded under
microscopes, and the
neutralizing titer was calculated by the dilution number of 50% protective
condition.
[0227] Bronchoalveolar lavage collection. Bronchoalveolar lavage (BAL) fluid
was
collected by washing the lungs of euthanized and exsanguinated mice with 700-
1000u1 of ice-
cold PBS containing 10011m EDTA, 0.05% sodium azide, 0.05% Tween 20, and lx
protease inhibitor (Pierce) (mucosal prep solutions (MPS)) with a blunt-ended
needle Guinea
pig lungs were washed with 20 ml of MPS via 16G catheter inserted into the
trachea.
Collected BAL fluid was stored at -20 C until the time of assay.
[0228] IFN-y ELISpot. Mice: Spleens from mice were collected individually in
RPM11640
media supplemented with 10% FBS (R10) and penicillin/streptomycin and
processed into
single cell suspensions. Cell pellets were re-suspended in 5 mL of ACK lysis
buffer (Life
Technologies, Carlsbad, CA) for 5 min at room temperature, and PBS was then
added to stop
the reaction. The samples were again centrifuged at 1,500 g for 10 min, cell
pellets re-
suspended in R10, and then passed through a 45 p.m nylon filter before use in
ELISpot assay.
ELISpot assays were performed using the Mouse IFN-y ELISpot' Lus plates
(MABTECH).
96-well ELISpot plates pre-coated with capture antibody were blocked with RIO
medium
overnight at 4 C. 200,000 mouse splenocytes were plated into each well and
stimulated for
20 hours with pools of 15-mer peptides overlapping by 9 amino acid from the
SARS-CoV-2,
SARS-CoV, or MERS-CoV Spike proteins (5 peptide pools per protein).
Additionally,
matrix mapping was performed using peptide pools in a matrix designed to
identify
immunodominant responses. Cells were stimulated with a final concentration of
51.1L of each
peptide/well in RPMI + 10% FBS (R10). The spots were developed based on
manufacturer's
instructions. R10 and cell stimulation cocktails (Invitrogen) were used for
negative and
positive controls, respectively. Spots were scanned and quantified by
ImmunoSpotTM CTL
- 55 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
reader. Spot-forming unit (SFU) per million cells was calculated by
subtracting the negative
control wells.
[0229] Flow cytometry. Intracellular cytokine staining was performed on
splenocytes
harvested from BALB/c and C57BL/6 mice stimulated with the overlapping
peptides
spanning the SARS-CoV-2 S protein for 6 hours at 37 C, 5% CO2. Cells were
stained with
the following antibodies from BD Biosciences, unless stated, with the
dilutions stated in
parentheses: FITC anti-mouse CD107a (1:100), PerCP-Cy5.5 anti-mouse CD4
(1:100), APC
anti-mouse CD8a (1:100), ViViD Dye (1-40) (LIVE/DEAD Fixable Violet Dead Cell
Stain
kit; Invitrogen, L34955), APC-Cy7 anti-mouse CD3e (1:100), and BV605 anti-
mouse IFN-y
(1:75) (eBiosciences). Phorbol Myristate Acetate (PMA) were used as a positive
control, and
complete medium only as the negative control. Cells were washed, fixed and,
cell events
were acquired using an FACS CANTO (BD Biosciences), followed by FlowJo
software
(FlowJo LLC, Ashland, OR) analysis.
[0230] Statistics. All statistical analyses were performed using GraphPad
Prism 7 or 8
software (La Jolla, CA). These data were considered significant if p <0.05.
The lines in all
graphs represent the mean value and error bars represent the standard
deviation. No samples
or animals were excluded from the analysis. Randomization was not performed
for the animal
studies. Samples and animals were not blinded before performing each
experiment.
[0231] Results
[0232] Design and synthesis of SARS-CoV-2 DNA vaccine constructs
[0233] Four spike protein sequences were retrieved from the first four
available SARS-
CoV-2 full genome sequences published on GISAID (Global Initiative on Sharing
All
Influenza Data). Three Spike sequences were 100% matched and one was
considered an
outlier (98.6% sequence identity with the other sequences). After performing a
sequence
alignment, the SARS-CoV-2 spike glycoprotein sequence ("Covid-19 spike
antigen"; SEQ
ID NO: 1) was generated and an N-terminal IgE leader sequence was added. The
highly
optimized DNA sequence encoding SARS-CoV-2 IgE-spike was created as described
elsewhere herein to enhance expression and immunogenicity. SARS-CoV-2 spike
outlier
glycoprotein sequence ("Covid-19 spike-OL antigen-; SEQ ID NO: 4) was
generated and an
N-terminal IgE leader sequence was added. The optimized DNA sequence was
synthesized,
digested with BamHI and XhoI, and cloned into the expression vector pGX0001
under the
control of the human cytomegalovirus immediate-early promoter and a bovine
growth
hormone polyadenylation signal. The resulting plasmids were designated as
pGX9501 and
- 56 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
pGX9503, designed to encode the SARS-CoV-2 S protein from the 3 matched
sequences and
the outlier sequence, respectively (Figure 1A).
[0234] In vitro characterization of synthetic DNA vaccine constructs
[0235] Expression of the encoded SARS-CoV-2 spike transgene at the RNA level
in COS-7
cells transfected with pGX9501 and pGX9503 was measured. Using the total RNA
extracted
from the transfected COS-7 cells, expression of the spike transgene was
confirmed by RT-
PCR (Figure 1B). In vitro spike protein expression in 2931 cells was measured
by Western
blot analysis using a cross-reactive antibody against SARS-CoV S protein on
cell lysates.
Western blots of the lysates of HEK-293T cells transfected with pGX9501 or
pGX9503
constructs revealed bands approximate to the predicted S protein molecular
weight, 140-142
kDa, with slight shifts likely due to the 22 potential N-linked glycans in the
S protein (Figure
1C). In immunofluorescent studies, the S protein was detected in 293T cells
transfected with
pGX9501 or pGX9503 (Figure 1D). In summary, in vitro studies revealed the
expression of
the Spike protein at both the RNA and protein level after transfection of cell
lines with the
candidate vaccine constructs.
[0236] Humoral immune responses in mice. pGX9501 was selected as the vaccine
construct to advance to immunogenicity studies, due to the broader coverage it
would likely
provide compared to the outlier, pGX9503. pGX9501 was subsequently termed INO-
4800. The
immunogenicity of INO-4800 was evaluated in BALB/c mice, post-administration
to the
tibialis anterior muscle using the CELLECTRA delivery device. (Sardesai &
Weiner, Curr.
Opin. Immunol., 23, 421-429 (2011). The reactivity of the sera from a group of
mice
immunized with INO-4800 was measured against a panel of SARS-CoV-2 and SARS-
CoV
antigens (Figure 2). Analysis revealed IgG binding against SARS-CoV-2 S
protein antigens,
with limited cross-reactivity to SARS-CoV S protein antigens in the sera of
INO-4800-
immunized mice. The serum IgG binding endpoint titers in mice immunized with
pDNA
against recombinant SARS-CoV-2 spike protein Sl+S2 regions (Figure 3A and 3B)
and
recombinant SARS-CoV-2 spike protein receptor binding domain (RBD) (Figures 3C
and 3D)
were measured. Endpoint titers were observed in the sera of mice at day 14
after immunization
with a single dose of INO-4800 (Figures 3B, 3C, 3D).
102371 Neutralization assay. A neutralization assay with a pNL4-3.Luc.R-E-
based
pseudovirus displaying the SARS-CoV-2 Spike protein was developed.
Neutralization titers
were detected by a reduction in relative luciferase units (RLU) compared to
controls which had
no decrease in RLU signal. BALB/c mice were immunized twice with INO-4800, on
days 0
- 57 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
and 14, and sera was collected on day 7 post-211d immunization. The
pseudovirus was incubated
with serial dilutions of mouse sera and the sera-virus mixture was added to
293T cells stably
expressing the human ACE2 receptor (ACE2-293T) for 72 hours. Neutralization
ID50 average
titers of 92.2 were observed in INO-4800 immunized mice (Figures 4A and 4B).
No reduction
in RLU was observed for the control animals. Neutralizing titers were
additionally measured
against two wildtype SARS-CoV-2 virus strains by plaque reduction
neutralization test
(PRNT) assay. Sera from INO-4800 immunized BALB/c mice neutralized both SARS-
CoV-
2/WH-09/human/2020 and SARS-CoV-2/AustraliaNIC01/2020 virus strains with
average
ND50 titers of 97.5 and 128.1, respectively (Table 1). Live virus neutralizing
titers were also
evaluated in C57BL/6 mice following the same INO-4800 immunization regimen.
Sera from
INO-4800 immunized C57BL/6 mice neutralized wildtype SARS-CoV-2 virus with
average
ND50 titer of 340 (Table 1).
102381 Table 1. Sera neutralizing activity after INO-4800 administration to
mice and
guinea pigs.
Samp Serum
Immunization le Neutralization ND50
Model Vaccine N
Regimen Time Assay
(Reciprocal
point
Dilution)
SARS-CoV-2
25 jig Day <70,
<70,
pVAX 4 (WH-
Days 0, 14 21 <20,
<20
09/human/2020)
SARS-CoV-2
25 ng Day 30,
40, 80,
INO-4800 4 (WH-
Days 0, 14 21 240
09/human/2020)
SARS-C oV-2 <10,
12, 13,
25 jig Day
BALB pVAX 8 (Australia/VIC01/202
15, 16, 17,
Days 0, 14 21
/c 0)
19,24
Mouse 27,
46, 91,
SARS-CoV-2
25 ng Day 108,
130,
INO-4800 8 (AustraliaNIC01/202
Days 0, 14 21 161,
221,
0)
241
ng Day SARS-CoV-2
pVAX 5 8, 8,
8, 8, 8
Days 0, 14 21 Ps eudovi rus
10 jig Day SARS-C oV-2 43,
55, 87,
INO-4800 5
Days 0, 14 21 Ps eudovirus 129,
147
25 jig Day <20,
<20,
pVAX 4 SARS-CoV-2
Days 0, 14 21 <20,
<20
- 58 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
(WH-
057B 09/human/2020)
L/6 SARS-CoV-2
Mouse INO-4800 4 25 jig Day (WH-
240,
240,
Days 0, 14 21 240,
640
09/human/2020)
SARS-CoV-2
100 pig Day <10,
14, 20,
pVAX 5 (AustraliaNIC01/202
Days 0, 14, 28 42 21'
25 0)
SARS-CoV-2 >320,
>320,
100 mg Day
INO-4800 5 (AustraliaNIC01/202
>320, >320,
Days 0, 14, 28 42
Guinea 0) >320
pig <20,
<20,
100 lig Day SARS-CoV-2
<20,
<20,
pVAX 5
Days 0, 14, 28 35 Pseudovirus
<20
527,
532,
100 lug Day SARS-CoV-2
INO-4800 5 579,
614,
Days 0, 14, 28 35 Pseudovirus
616
<10,
<10,
SSC 5 Days 0, 28 Day SARS-CoV-2 <10,
<10,
42 Pseudovirus
<10
New
Zealand 1 mg, Days 0, Day SARS-CoV-2 12, 23, 32,
INO-4800 5
White 28 42 Pseudovirus 148,
178
Rabbit
202,
237,
2mg, Days 0. Day SARS-CoV-2
INO-4800 5 252,
455,
28 42 Pseudovirus
995
1 mg, Days 0, Day SARS-CoV-2 15,
27, 55,
INO-4800 5
Non- 28 42 Pseudovirus 61,
1489
human
primates PO 4800 5 2mg, Days 0. Day SARS-CoV-2 78,
23, 13,
28 42 Pseudovirus
48,<10
102391 The immunogenicity of INO-4800 in the Hartley guinea pig model, an
established
model for intradermal vaccine delivery (Carter, et al. The adjuvant GLA-AF
enhances human
intradermal vaccine responses. Sci Adv. 2018;4(9):eaas9930; Schultheis, et al.
Characterization of guinea pig T cell responses elicited after EP-assisted
delively of DNA
vaccines to the skin. Vaccine. 2017;35(1):61-70), was assessed. 100 Kg of pDNA
was
administered by Mantoux injection to the skin and followed by CELLECTRAV
device on
day as described in the methods section above. On day 14, anti-spike protein
binding of
serum antibodies was measured by ELISA. Immunization with INO-4800 revealed an
- 59 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
immune response in respect to SARS-CoV-2 S1+2 protein binding IgG levels in
the sera
(Figures 5A and 5B). The endpoint SARS-CoV-2 S protein binding titer at day 14
was
10,530 and 21 in guinea pigs treated with 100 lig INO-4800 or pVAX (control),
respectively
(Figure 5B). Antibody neutralizing activity following intradermal INO-4800
immunization
in the guinea pig model was evaluated. Guinea pigs were treated on days 0, 14,
and 28 with
pVAX or INO-4800, and sera samples were collected on days 35 or 42 to measure
sera
neutralizing activity against pseudovirus or wildtype virus, respectively.
SARS-CoV-2
pseudovirus neutralizing activity with average ND50 titers of 573.5 was
observed for the
INO-4800 immunized guinea pigs (Table 1). Wildtype SARS-CoV-2 virus activity
was also
observed for the INO-4800 immunized guinea pigs with ND50 titers >320 by PRNT
assay
observed in all animals (Table 1). The functionality of the serum antibodies
was further
measured by assessing their ability to inhibit ACE2 binding to SARS-CoV-2
spike protein.
Serum (1:20 dilution) collected from INO-4800 immunized guinea pigs after 2nd
immunization inhibited binding of SARS-CoV-2 Spike protein over range of
concentrations
of ACE-2 (0.25 p.g/m1 through 4 lag/m1) (Figure 6E). Furthermore, serum
dilution curves
revealed serum collected from INO-4800 immunized guinea pigs blocked binding
of ACE-2
to SARS-CoV-2 in a dilution-dependent manner (Figure 6F). Serum collected from
pVAX-
treated animals displayed negligible activity in the inhibition of ACE-2
binding to the virus
protein, the decrease in OD signal at the highest concentration of serum is
considered a
matrix effect in the assay.
[0240] Inhibition of SARS-CoV-2 S protein binding to ACE2 receptor. The
receptor
inhibiting functionality of INO-4800-induced antibody responses was examined.
An ELISA-
based ACE2 inhibition assay was developed as a surrogate for neutralization.
As a control in
the assay, ACE2 is shown to bind to SARS-CoV-2 Spike protein with an EC50 of
0.025
jig/ml (Figure 6A). BALB/c mice were immunized on Days 0 and Day 14 with 10
jig of
INO-4800, and serum IgG was purified on Day 21 post-immunization to ensure
inhibition is
antibody-mediated. Inhibition of the Spike-ACE2 interaction using serum IgG
from a naïve
mouse and from an INO-4800 vaccinated mouse were compared (Figure 6B). The
receptor
inhibition assay was repeated with a group of five immunized mice,
demonstrating that INO-
4800-induced antibodies competed with ACE2 binding to the SARS-CoV-2 Spike
protein
(Figure 6C and 6F). ACE2 binding inhibition was further evaluated in the
guinea pig model.
Sera collected from INO-4800 immunized guinea pigs inhibited binding of SARS-
CoV-2
Spike protein over range of concentrations of ACE2 (0.25 jig/ml through 4
ug/m1) (Figure
6D). Furthermore, serum dilution curves revealed sera collected from INO-4800
immunized
- 60 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
guinea pigs blocked binding of ACE2 to SARS-CoV-2 in a dilution-dependent
manner
(Figure 6E). Sera collected from pVAX-treated animals displayed negligible
activity in the
inhibition of ACE2 binding to the virus protein, the decrease in OD signal at
the highest
concentration of serum is considered a matrix effect in the assay. Figure 6F
depicts IgGs
purified from n=5 mice day 14 post second immunization with INO-4800 show
competition
against ACE2 receptor binding to SARS-CoV-2 Spike protein compared to pooled
naïve
mice IgGs.
[0241] In summary, immunogenicity testing in both mice and guinea pigs
revealed the
SARS-CoV-2 vaccine candidate, INO-4800, was capable of eliciting antibody
responses to
SARS-CoV-2 spike protein. ACE2 is considered to be the primary receptor for
SARS-CoV-2
cellular entry, blocking this interaction suggests INO-4800-induced antibodies
may prevent
host infection.
102421 Biodistribution of SARS-CoV-2 reactive IgG to the lung. Lower
respiratory
disease (LRD) is associated with severe cases of COVID-19. The presence of
antibodies at
the lung mucosa targeting SARS-CoV-2 could potentially mediate protection
against LRD_
The presence of SARS-CoV-2 specific antibody in the lungs of immunized mice
and guinea
pigs was evaluated. BALB/c mice and Hartley guinea pigs were immunized, on
days 0 and
14 or 0, 14 and 28, respectively, with 1140-4800 or pVAX control pDNA.
Bronchoalveolar
lavage (BAL) fluid was collected following sacrifice, and SARS-CoV-2 S protein
ELISAs
were performed. In both BALB/c and Hartley guinea pigs which received INO-
4800, a
statistically significant increase in SARS-CoV-2 S protein binding IgG in BAL
fluid
compared to animals receiving pVAX control was measured (Figures 7A-7D). Taken
together, these data demonstrate the presence of anti-SARS-CoV-2 specific
antibody in the
lungs following immunization with INO-4800.
[0243] Coronavirus cross-reactive cellular immune responses in mice. T cell
responses
against SARS-CoV-2, SARS-CoV, and MERS-CoV S antigens were assayed by IFN-y
ELISpot. Groups of BALB/c mice were sacrificed at days 4, 7, or 10 post-INO-
4800
administration (2.5 or 10 lig of pDNA), splenocytes were harvested, and a
single-cell
suspension was stimulated for 20 hours with pools of 15-mer overlapping
peptides spanning
the SARS-CoV-2, SARS-CoV, and MERS-CoV spike protein. Day 7 post-INO-4800
administration, T cell responses of 205 and 552 SFU per 106 splenocytes
against SARS-CoV-
2 were measured for the 2.5 and 10 lig doses, respectively (Figure SA). Higher
magnitude
responses of 852 and 2,193 SFU per 106 splenocytes against SARS-CoV-2 were
observed on
Day 10 post-INO-4800 administration. Additionally, the cross-reactivity of the
cellular
- 61 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
response elicited by INO-4800 against SARS-CoV was assayed, showing
detectable, albeit
lower, T cell responses on both Day 7 (74 [2.5 lig dose] and 140 [10 lig dose]
SFU per 106
splenocytes) and Day 10 post-administration (242 [2.5 jig dose] and 588 [10
jig dose] SFU
per 106 splenocytes) (Figure 8B). Interestingly, no cross-reactive T cell
responses were
observed against MERS-CoV peptides (Figure 8C). Representative images of the
IFN-y
ELISpot plates are provided in Figure 31. The T cell populations which were
producing IFN-
y were identified. Flow cytometric analysis on splenocytes harvested from
BALB/c mice on
Day 14 after a single INO-4800 immunization revealed the T cell compartment to
contain
0.04% CD4+ and 0.32% CD8+ IFN-y+ T cells after stimulation with SARS-CoV-2
antigens
(Figure 32).
[0244] BALB/c SARS-CoV-2 epitope mapping. Epitope mapping was performed on the
splenocytes from BALB/c mice receiving the 10 mg INO-4800 dose. Thirty matrix
mapping
pools were used to stimulate splenocytes for 20 hours and immunodominant
responses were
detected in multiple peptide pools (Figure 14A). The responses were
deconvoluted to
identify several epitopes (H2-Kd) clustering in the receptor binding domain
and in the S2
domain (Figure 14B). Interestingly, one SARS-CoV-2 H2-Kd epitope, PHGVVFLHV
(SEQ
ID NO: 16), was observed to be overlapping and adjacent to the SARS-CoV human
HLA-A2
restricted epitope VVFLHVTVYV (SEQ ID NO: 17).
[0245] In summary, T cell responses against SARS-CoV-2 S protein epitopes were
detected
in mice immunized with INO-4800.
[0246] Example 2 - Cellular and humoral immune responses measured in INO-4800-
treated New Zealand White (NZW) rabbits.
[0247] Day 0 and 28 intradermal delivery of pDNA. PBMC IFN-y ELISpot (Figure
9);
Serum IgG binding ELISA (Figure 10).
102481 Example 3
[0249] Humoral immune responses to SARS-CoV-2 spike protein measured in INO-
4800 treated in rhesus monkeys. Day 0 and 28 intradermal delivery of pDNA.
Serum IgG
binding ELISA. (Figures 11A-11E.)
102501 Humoral immune responses to SARS and MERS spike protein measured in
INO-4800 treated rhesus monkeys. Day 0 and 28 intradermal delivery of pDNA.
Serum
IgG binding ELISA. (Figures 12A-12G; left panel, 1 mg INO-4800; right panel, 2
mg INO-
4800).Cellular immune responses measured by PBMC IFN-y ELISpot in INO-4800-
treated in rhesus monkeys following intradermal delivery of pDNA on days 0 and
28.
- 62 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
Results are shown in Figure 13A (SARS CoV-2 Spike peptides); 13B (SARS CoV
Spike
peptides); and 13C (MERS CoV Spike peptides).
[0251] Example 4 INO-4800 SARS-CoV-2 Spike ELISA Assay
[0252] The SARS-CoV-2 spike protein is coated onto wells of a 96-well
microplate by
incubating over night or for up to three days. Blocking buffer is then added
to block
remaining free binding sites. Human serum samples containing antibodies to
SARS-COV-2
spike protein and assay controls are added to the blocked plate and incubated
for 1 hour.
During the incubation, anti-spike protein antibodies present in the samples
and positive
controls bind to spike protein immobilized onto the plate. Plates are then
washed to remove
unbound serum components. Next, a horseradish peroxidase (HRP) labeled anti-
human IgG
antibody is added to allow for detection of antibody bound to the spike
protein. After a one
hour incubation, plates are washed to remove unbound HRP detection antibody,
and TMB
substrate is added to plates. In the presence of horseradish peroxidase, the
TMB substrate
turns deep blue, proportional to the amount of HRP present in the well. After
allowing the
reaction to proceed for approximately 10 minutes, an acid-based stop solution
is added,
which halts the enzymatic reaction and turns the TMB yellow. The yellow color
is
proportional to the amount of bound anti-spike protein antibodies in each well
and is read at
450 nm. The magnitude of the assay response is expressed as titers. Titer
values are defined
as the greatest serial dilution at which the assay signal is greater than a
cutoff value based on
the assay background levels for a panel of serum from normal human donors.
[0253] ELISA Assay Method Qualification
[0254] The INO-4800 SARS-CoV-2 Spike ELISA assay has been qualified and has
been
found suitable for the its intended use to measure the humoral response in
subjects
participating in clinical trials involving INO-4800. The formal qualification
consisted of 18
plates and was conducted by two operators over the course of four days. The
qualification
determined the assay sensitivity, specificity, selectivity, and precision. At
the time the assay
was developed convalescent sera was not available. A monoclonal antibody was
therefore
used in development. The monoclonal antibody diluted in normal human sera was
used to
test all parameters in this assay. The overall assay sensitivity was found to
be 16.1 ng/mL for
1/20-diluted serum, which is 322 ng/mL for undiluted serum. Specificity was
assessed by
pre-incubating anti-spike protein antibody with recombinant spike protein
prior to assay.
Preincubation with the recombinant spike protein resulted in greater than 60%
signal
- 63 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
reduction, indicating that the antibody was binding specifically to the spike
protein coated to
the plate and not to a different assay component. Selectivity was investigated
by spiking
individual human serum samples with positive control anti-spike antibody at a
concentration
near the limit of detection. Seven out of 10 individuals had signal above the
cutoff, and eight
out of the ten individuals had assay signal within 20% of the mean signal for
the ten
individuals, demonstrating that matrix effects are expected to be minor for
most human serum
samples when diluted 1/20. Assay precision was assessed by assaying a high,
low, and
medium anti-spike protein antibody positive control six times on each of six
plates. Results
indicated low intra-assay raw signal variation but high raw signal inter-assay
variation. Since
each individual plate cutoff is based on the signal of negative controls on
each plate, inter-
assay variation in raw signal is not expected to influence the precision of
final titer
calculations. To test this, the precision of plate cutoffs was evaluated in
this qualification by
titering the HPC (high positive control) six times on each of six plates for a
total of thirty-six
titer evaluations. Thirty-five out of the thirty-six values were identical
(titer of 180), while
one of the titer determinations was one step lower than the rest (60 instead
of 180). This
resulted in an inter-assay CV of 4.6%.
[0255] Example 5 INO-4800 SARS-CoV-2 Spike ELISPOT Assay
[0256] The enzyme-linked immunospot (ELISPOT) assay is a highly sensitive
immunoassay that measures the frequency of cytokine-secreting cells at the
single-cell level.
In this assay, cells are cultured on a surface coated with a specific capture
antibody in the
presence or absence of stimuli. After an appropriate incubation time, cells
are removed and
the secreted molecule is detected using a detection antibody in a similar
procedure to that
employed by the ELISA. The detection antibody is biotinylated and followed by
a
streptavidin-enzyme conjugate. By using a substrate with a precipitating
rather than a soluble
product, the end result is visible spots on the surface. Each spot corresponds
to an individual
cytokine-secreting cell. The IFN-y ELISPOT assay qualification was
successfully completed
with an assessment of assay specificity, reproducibility and precision (intra-
assay precision
and inter-assay precision), dynamic range, linearity, relative accuracy, limit
of detection and
quantitation and assay robustness. The assay has been tested and qualified
under GLP/GCLP
laboratory guidelines.
102571 ELISPOT Assay Method Qualification. Specificity readings gave a mean
value of
<10 spot-forming units (SFU) for the assay negative control (medium with
DMS0), a mean
of 565 SFU for the positive control peptide pool CEF and a mean of 593 SFU in
response to
stimulation with mitogen (Phorbol Myristate Acetate + lonomycin). The highest
reported
- 64 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
%CV for intra-assay variation was 7.37%. The highest reported %CV for inter-
assay
variation was 17.23%. The highest observed %CV for inter-operator variability
was 8.11 %.
These values fall below the FDA-recommended standard acceptance criteria of
20%.
102581 Linearity of the dilution curve was demonstrated with a slope of 0.15
and an R2
value of 0.99. Assay accuracy was >90% over the listed dynamic range (156-5000
cells/well), falling within the acceptance criteria of 80-120%. Limit of
detection was
determined to be 11 SFU/1x106 PBMCs, limit of quantitation was observed at 20
SFU/1x106
PBMCs. Robustness of the assay was evaluated by varying (i) peptide
concentration; (ii)
secondary antibody concentration; (iii) incubation times, and (iv) drying-out
of plate
membranes.
[0259] Based on the results of this qualification, the IFN-y ELISPOT is
considered
qualified and ready for use in clinical trials.
[0260] Example 6 Phase 1 Open-label Study to Evaluate the Safety, Tolerability
and
Immunogenicity of INO-4800, a Prophylactic Vaccine Against SARS-CoV-2,
Administered Intradermally Followed by Electroporation in Healthy Volunteers
[0261] This is a Phase 1, open-label, multi-center trial (clinicaltrials_gov
identifier
NCT04336410) to evaluate the safety, tolerability and immunological profile of
INO-4800
(pGX9501) administered by intradermal (ID) injection followed by
electroporation (EP)
using CELLECTRA 2000 device in healthy adult volunteers. Approximately 40
healthy
volunteers will be evaluated across two (2) dose levels: Study Group 1 and
Study Group 2 as
shown in Table 2. A total of 20 subjects will be enrolled into each Study
Group.
[0262] Table 2: COVID19-001 Base Study Dose Groups
Number Number of INO-4800 INO-4800
Total Dose of
Study of Dosing Injections + EP (mg) per (mg)
per INO-4800
Group Subjects Weeks per Dosing Visit
injection Dosing Visit (mg)
1 20 0,4 1 1.0 1.0 2.0
2 20 0, 4 2a 1.0 2.0 4.0
Total 40
aINO-4800 will be injected ID followed by EP in an acceptable location on two
different limbs at each dosing visit
[0263] All subjects will be followed for 24 weeks following the last dose.
Week 28 will be
the End of Study (EOS) visit.
[0264] Primary Objectives:
- 65 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
= Evaluate the tolerability and safety of INO-4800 administered by ID
injection
followed by EP in healthy adult volunteers
= Evaluate the cellular and humoral immune response to INO-4800
administered by ID
injection followed by EP
[0265] Primary Safety Endpoints:
= Incidence of adverse events by system organ class (SOC), preferred term
(PT),
severity and relationship to investigational product
= Administration (i.e., injection) site reactions (described by frequency
and severity)
= Incidence of adverse events of special interest
[0266] Primary Immunogenicity Endpoints:
= SARS-CoV-2 Spike glycoprotein antigen-specific antibodies by binding
assays
= Antigen-specific cellular immune response by IFN-y, ELISpot and/or flow
cytometry
assays
[0267] Exploratory Objective:
= Evaluate the expanded immunological profile by assessing both T and B
cell
immune response
102681 Exploratory Endpoint:
= Expanded immunological profile which may include (but not limited to)
additional assessment of T and B cell numbers, neutralization response and T
and B
cell molecular changes by measuring immunologic proteins and mRNA levels of
genes of interest at all weeks as determined by sample availability
[0269] Safety Assessment:
[0270] Subjects will be followed for safety for the duration of the trial
through the end of
study (EOS) or the subject's last visit. Adverse events will be collected at
every visit (and a
Day 1 phone call). Laboratory blood and urine samples will be drawn at
Screening, Day 0
(pregnancy test only), Week 1, Week 4 (pregnancy test only), Week 6, Week 8,
Week 12 and
Week 28, according to the Schedule of Events (Table 3). All adverse events,
regardless of
relationship, will be collected from the time of consent until EOS. All
serious adverse events,
- 66 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
adverse events of special interest and treatment-related adverse events will
be followed to
resolution or stabilization.
- 67 -
CA 03168353 2022- 8- 17

9
a
:cT:
.D,'
]
0
N
[0271] Table 3. Clinical Trial Schedule of Events
N
-'
w
Day 0 Day 1 Week 1 Week 4 Week 6
Week 8 Week 12 Week 28 oe
Tests and assessments Screen' ( 5d)
N
,L0
(+1d) ( 3d) ( 5d)
( 5d) ( 5d) ( Sd)
Pre Post Pre Post
Informed Consent X
Inclusion/Exclusion
X
Criteria
Medical History X X
Demographics X
Concomitant Medications X X X X X
X X X
Physical Examb X X X X X
X X X
Vital Signs X X X X X
X X X
1 Height and Weight X
c., CBC with Differential X X X
X X X
oc
1 Chemistry' X X X
X X X
Serologyd X
12-lead ECG X
Urinalysis Routine' X X X
X X X
Pregnancy Test X X X
INO-4800 + EPg Xk X"
Download EP Data X X
Adverse Events X X X Xk X X X X
X X X
Immunology (Whole
t
X X X X X X
X n
blood)1
-i
",--
Immunology (Serum)tm X X X X
X X X cp
N
=
N
-.'
7:5
a
a
N

5
Table 3 (cont.)
a. Screening assessment occurs from -30 days to -1 day prior to Day 0.
b. Full physical examination at screening and Week 28 (or any other study
discontinuation visit) only. Targeted physical exam at all other visits. oe
r.)
c. Includes Na, K, Cl, HCO3, Ca. PO4, glucose, BUN, and Cr.
d. HIV antibody or rapid test, HEsAg, HCV antibody.
e. Dipstick for glucose, protein, and hematuria. Microscopic examination
should be performed if dipstick is abnormal.
f. Serum pregnancy test at screening. Urine pregnancy test at other visits.
g. All doses delivered via intradermal injection followed by EP.
h. For Study Group 1, one injection in skin preferably over deltiod muscle
at Day 0 and Week 4. For Study Group 2, two injections in skin with each
injection
over a different deltoid or lateral quadriceps: preferably over the deltoid
muscles, at Day 0 and Week 4.
i. Following administration of IN0-4800, EP data will be downloaded from
the CELLECTRAt 2000 device and provided to Inovio.
j. Includes AEs from the time of consent and all injection site reactions
that qualify as an AE.
k. Follow-up phone call to collect AEs.
1. 4 x 8.5 nil (34 ml..) whole blood in 10 ml.. Acid Citrate
Dextrose (ACD, Yellow top) tubes per time point. Note: Collect a total of 68
mL whole blood prior
to 1st dose (screening and prior to Day 0 dosing).
m. 1 x 8 inL blood in 10 inL red top serum collection tube per
time point. Note: Collect four aliquots of 1 ruL each (total 4 mL) serum at
each time point prior
to 1st dose (Screening and prior to Day 0 dosing).
ri
L.)
L.)
===-=
L.)

WO 2021/173829
PCT/US2021/019662
[0272] Immunogenicity Assessment:
[0273] Immunology blood samples will be collected at Screening, Day 0 (prior
to dose),
Week 4 (prior to dose), Week 6, Week 8, Week 12 and Week 28. Determination of
analysis
of collected samples for immunological endpoints will be determined on an
ongoing basis
throughout the study.
[0274] Clinical Trial Population:
[0275] Healthy adult volunteers between the ages of 18-50 years, inclusive.
[0276] Inclusion Criteria:
a. Adults aged 18 to 50 years, inclusive:
b. Judged to be healthy by the investigator on the basis of medical
history,
physical examination and vital signs performed at Screening;
c. Able and willing to comply with all study procedures;
d. Screening laboratory results within normal limits or deemed not
clinically
significant by the Investigator;
e. Negative serological tests for Hepatitis B surface antigen (HBsAg),
Hepatitis
C antibody and Human Immunodeficiency Virus (HIV) antibody screening;
Screening electrocardiogram (ECG) deemed by the Investigator as having no
clinically significant findings (e.g. Wolff-Parkinson-White syndrome);
g. Use of medically effective contraception with a failure
rate of < 1% per year
when used consistently and correctly from screening until 3 months following
last
dose, be post-menopausal, be surgically sterile or have a partner who is
sterile.
[0277] Exclusion Criteria:
a. Pregnant or breastfeeding, or intending to become pregnant or father
children
within the projected duration of the trial starting with the screening visit
until 3
months following last dose;
b. Is currently participating in or has participated in a study with an
investigational product within 30 days preceding Day 0;
c. Previous exposure to SARS-CoV-2 (laboratory testing at the
Investigator's
discretion) or receipt of an investigational vaccine product for prevention of
COVID-
19, MERS or SARS;
d. Current or history of the following medical conditions:
- 70 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
= Respiratory diseases (e.g., asthma, chronic obstructive pulmonary
disease);
= Hypertension, sitting systolic blood pressure >150 mm Hg or a diastolic
blood
pressure >95 mm Hg;
= Malignancy within 5 years of screening;
= Cardiovascular diseases (e.g., myocardial infarction, congestive heart
failure,
cardiomyopathy or clinically significant arrhythmias);
e. Immunosuppression as a result of underlying illness or
treatment including:
= Primary immunodeficiencies;
= Long term use (>7 days) of oral or parenteral glucocorticoids;
= Current or anticipated use of disease modifying doses of anti-rheumatic
drugs
and biologic disease modifying drugs;
= History of solid organ or bone marrow transplantation;
= Prior history of other clinically significant immunosuppressive or
clinically
diagnosed autoimmune disease.
Fewer than two acceptable sites available for ID injection and EP considering
the deltoid and anterolateral quadriceps muscles;
g. Any physical examination findings and/or history of any
illness that, in the
opinion of the study investigator, might confound the results of the study or
pose an
additional risk to the patient by their participation in the study.
[0278] Clinical Trial Treatment: The INO-4800 drug product contains 10 mg/mL
of the
DNA plasmid pGX9501 in lx SSC buffer (150 mM sodium chloride and 15 mM sodium
citrate). A volume of 0.4 mL will be filled into 2-nit glass vials that are
fitted with rubber
stoppers and sealed aluminum caps. INO-4800 is stored at 2-8 C.
[0279] Study Group 1 is administered one 1.0 milligram (mg) intradermal (ID)
injection of
INO-4800 followed by electroporation (EP) using the CELLECTRAk 2000 device per
dosing visit at Day 0 and Week 4. Study Group 2 is administered two 1.0 mg ID
injections
(total 2.0 mg per dosing visit) (in an acceptable location on two different
limbs) of I1NO-4800
followed by EP using the CELLECTRA 2000 device at Day 0 and Week 4.
[0280] Peripheral Blood Immunogenicity Assessments
-71 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0281] Whole blood and serum samples are obtained. Immunology blood and serum
samples are collected at Screening and at visits specified in the Schedule of
Events (Table 2).
Both Screening and Day 0 immunology samples are required to enable all
immunology
testing. The T and B cell immune responses to INO-4800 are measured using
assays that may
include but are not limited to ELISA, neutralization, assessment of
immunological gene
expression, assessment of immunological protein expression, flow cytometry and
ELISPOT.
The ELISA binding assay is a standard plate-based ELISA using 96-well ELISA
plates.
Plates are coated with SARS-CoV-2 spike protein and blocked. Following
blocking, sera
from vaccinated subjects are serially diluted and incubated on the plate. A
secondary
antibody that is able to bind human IgG is used to assess the level of vaccine
specific
antibodies in the sera. T-cell response is assessed by an TEN-gamma ELISPOT
assay.
PBMCs isolated from study volunteers are incubated with peptide fragments of
the SARS-
CoV-2 spike protein. The cells and peptides are placed in a MabTech plates
coated with an
antibody that captures 1FN-gamma. Following 24 hours of stimulation, cells are
washed out
and a secondary antibody that binds IFN-gamma is added. Each vaccine specific
cell creates
a spot that can be counted to determine the level of cellular responses
induced. In addition,
humoral responses to SARS-CoV-2 Nucleocapsid Protein (NP) may also be assessed
to rule
out potential infection by wild-type SARS-CoV-2 post INO-4800 treatment during
the study.
Determination of analysis of collected samples for immunological endpoints are
determined
on an ongoing basis throughout the study.
[0282] Primary Outcome Measure:
1.Percentage of Participants with Adverse Events (AEs) [Time Frame: Baseline
up to
Week 28]
2. Percentage of Patients with Administration (Injection) Site Reactions Time
Frame:
Day 0 up to Week 281
3. Incidence of Adverse Events of Special Interest (AESIs) Time Frame:
Baseline up
to Week 28]
4. Change from Baseline in Antigen-Specific Binding Antibody Titers [Time
Frame:
Baseline up to Week 281 A subject is considered to have a positive antibody
response
if the optical density post vaccine is 2.0 SD higher than the optical density
at day 0
and above the ELISA specific cut off.
- 72 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
5. Change from Baseline in Antigen-Specific Interferon-Gamma (IFN-y) Cellular
Immune Response [Time Frame: Baseline up to Week 281 A subject is considered
to
have a positive cellular response if the number of IFN-gamma producing cells
(spots)
post vaccine is 2.0 SD higher than the number of spots at day 0 and above the
assay
LOD.
[0283] The safety of INO-4800 is measured and graded in accordance with the
"Toxicity
Grading Scale for Healthy Adult and Adolescent Volunteers Enrolled in
Preventive Vaccine
Clinical Trials", issued September 2007 (Appendix A). An adverse event of
special interest
(AES1) (serious or non-serious) is one of scientific and medical concern
specific to the
product or program. AESIs include those listed in Table 4.
[0284] Table 4.
Body System AESI
Acute respiratory distress syndrome (ARDS)
Respiratory
Pneumonitis/Pneumonia
Generalized convulsion
Aseptic meningitis
Guillain-Barre Syndrome (GBS)
Neurologic
Encephalitis/Myelitis
Acute disseminated encephalomyelitis (ADEM)
CNS vasculopathy (stroke)
Thrombocytopenia
Hematologic
Disseminated intravascular coagulation (DIC)
Anaphylaxis
Immunologic Vasculitides
Enhanced disease following immunization
Local/systemic SAEs
Other Acute cardiac injury
Acute kidney injury
Septic shock-like syndrome
[0285] DOSE LIMITING TOXICITY (DLT)
[0286] For the purpose of this clinical trial, the following are dose limiting
toxicities:
= Grade 3 or greater local injection site erythema, swelling and/or
induration observed?
1 day after INO-4800 administration (see Table 5);
= Pain or tenderness at the injection site that requires hospitalization
despite proper use
of non-narcotic analgesics:
- 73 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
= Grade 4 or greater non-injection site adverse event assessed by the PI as
related to
INO-4800 administration;
= Grade 4 or greater clinically significant laboratory abnormalities
assessed by the PI as
related to INO-4800 administration.
[0287] Table 5. Grading Scale for Injection Site Reactions
Local Reaction to
Injectable Product
Potentially Life
(Grade) Mild (1) Moderate (2) Severe (3)
Threatening (4)
Repeated use of Any use of
Does not non-narcotic pain narcotic pain
Emergency room
Pain interfere with reliever >24 hours reliever or
visit or
activity or interferes with
prevents daily hospitalization
activity activity
T d Mild discomfort Discomfort with
Significant ER visit or
en erness
to touch movement discomfort at rest
hospitalization
Necrosis or
Erythema/Rednessa 2.5-5 cm 5.1-10 cm >10 cm
exfoliative
dermatitis
2.5-5 cm and no 5.1-10 cm or >10 cm or
Induraiion/Swellingb interference w/ interferes with prevents daily
Necrosis
activity activity activity
September 2007 "FDA Guidance for Indusby-Toxicity Grading Scale for Healthy
Adult and Adolescent Volunteers Enrolled in
Preventive Vaccine Clinical Trials"
In addition to grading the measured local reaction at the greatest single
diameter, the measurement should be recorded as a continuous
variable
b Should be evaluated and graded using the functional scale as well as the
actual measurement.
[0288] ANALYTICAL POPULATIONS
[0289] Analysis populations are:
= The modified intention to treat (mITT) population includes all subjects
who receive at
least one dose of the INO-4800. Subjects in this sample are analyzed by their
assigned
dose group of IN 0-4800. The m1TT population are used to analyze co-primary
and
exploratory immunological endpoints.
- 74 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
= The per-protocol (PP) population is comprised of mITT subjects who
receive all their
planned administrations and who have no Medical Monitor-assessed important
protocol violations. Analyses on the PP population are considered supportive
of the
corresponding mITT analyses.
[0290] The safety analysis population includes all subjects who receive at
least one dose of
INO 4800 administered by ID injection. Subjects for this population are
grouped in
accordance with the dose of INO-4800 that they received. This population is
used for all
safety analyses in the study.
[0291] PRIMARY SAFETY ANALYSES
[0292] The primary analyses for this trial are safety analyses of treatment
emergent adverse
events (TEAEs), administration site reactions and clinically significant
changes in safety
laboratory parameters from baseline.
[0293] TEAEs are defined for this trial as any adverse events, adverse events
of special
interest, or serious adverse events that occur on or after Day 0 following IP
administration.
All TEAEs will be summarized by frequency, percentage and associated 95%
Clopper-
Pearson confidence interval. The frequencies are also presented separately by
dose number
and are depicted by system order class and preferred term. Additional
frequencies are
presented with respect to maximum severity and relationship to IP. Multiple
occurrences of
the same AE in a single subject are counted only once following a worst-case
approach with
respect to severity and relationship to IP. All serious TEAEs are summarized
as above. AE
duration is calculated as AE stop date ¨ AE start date + 1 day. AEs and SAEs
that are not
TEAEs or serious TEAEs are presented in listings.
[0294] All of these primary safety analyses are conducted on the subjects in
the safety
population.
[0295] PRIMARY IMMUNOGENICITY ANALYSES
[0296] SARS-CoV-2 Spike glycoprotein antigen specific binding antibody titers,
and
specific cellular immune responses are analyzed by Study Group within age
strata. Binding
antibody titer is analyzed for each Study Group using the geometric mean and
associated
95% confidence intervals. Antigen specific cellular immune response increases
are analyzed
for each Study Group using medians, inter-quartile range and 95% confidence
intervals.
- 75 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
Change from baseline for both binding antibody titer and antigen specific
cellular response
increases are analyzed using Geometric Mean Fold Rise and 95% confidence
intervals.
Binding antibody titers are analyzed between each Study Group pair within age
strata using
the geometric mean ratio and associated 95% confidence intervals. Antigen
specific cellular
immune responses are analyzed between each Study Group pair within age strata
using
median differences and associated 95% confidence intervals. All of these
primary
immunogenicity analyses are conducted on the subjects in the mITT and PP
populations.
[0297] EXPLORATORY ANALYSES
[0298] T and B post baseline cell number will be analyzed descriptively by
Study Group
with means/medians and associated 95% confidence intervals. Percent
neutralizing antibodies
will be analyzed for each Study Group using medians, inter-quartile range and
95%
confidence intervals.
[0299] The safety and immunogenicity of the optional booster dose of IN 0-4800
following
a prior two-dose regimen will be analyzed as described below. Live
neutralization reciprocal
antibody titer and pseudoneutralization reciprocal antibody titer will be
analyzed for each
Study Group within age strata using the geometric mean and associated 95%
confidence
intervals. Fold rise from baseline will tabulated for each immunogenic
biomarker. If there is
sufficient data for analysis, exploratory between group immunogenic
comparisons between
subjects who opt for just 2 administrations and subjects who opt for 2
administrations plus
the booster administration will be undertaken.
[0300] Further exploration of the effect of age and other potential
confounders on the
relationship between immune biomarkers and INO-4800 dose may involve the use
of
ANCOVA and/or Logistic regression models.
[0301] PRELIMINARY BASE STUDY RESULTS
[0302] All 8 adverse events reported were Grade 1; 5 due to local injection
site reactions.
No serious adverse events, adverse events of special interest, or dose
limiting toxicities were
reported.
[0303] Preliminary Binding ELISA Analysis demonstrated 7/9 (78%) subjects had
positive
antibody responses. Responders had a four-fold increase in titer.
- 76 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0304] At week six, multiple immunology assays, including those for humora1
and cellular
immune response, were conducted for both 1.0 mg and 2.0 mg dose cohorts after
two doses.
Analyses at that point showed that 94% (34 out of 36 total trial participants)
demonstrated
overall immunological response rates based on preliminary data assessing
humoral (binding
and neutralizing) and T cell immune responses. One participant in the 1 mg
dose cohort and
two participants in the 2 mg dose cohort were excluded from the immune
analyses as they
tested positive for COVID-19 immune responses at study entry, indicating prior
infection.
One participant in the 2 mg dose cohort discontinued the study for reasons
unrelated to safety
or tolerability.
[0305] Through week eight, INO-4800 was generally safe and well-tolerated in
all
participants in both cohorts. All ten reported adverse events (AEs) were grade
1 in severity,
with most being injection site redness. There were no reported serious adverse
events (SAEs).
[0306] INITIAL PHASE 1 RESULTS
[0307] Study Population Demographics
[0308] A total of 55 participants were screened and 40 participants were
enrolled into the
initial two groups (Figure 16). The median age was 34.5 years (range 18 to 50
years).
Participants were 55% male (Table 6). Most participants were white (82.5%).
[0309] Table 6
Variable Statistic Group 1, 1 mg Group 2,
2 mg Overall
(N=20) (N-20) (N=40)
Gender
Male n (0/0) 11 (55.0) 11 (55.0) 22
(55.0)
Female n (%) 9 (45.0) 9 (45.0) 18
(45.0)
Race
While n (%) 18 (90.0) 15 (75.0) 33
(82.5)
Black or n (%) 1(5.0) 1 (5.0) 2 (5.0)
African American
Asian n(%) 1(5.0) 4(20.0) 5(12.5)
Ethnicity
Hispanic or Latino n (%) 0 0 0
Not Hispanic or Latino n (A) 20 (100.0) 20 (100.0) 40
(100.0)
Age (years) n 20 20 40
Mean (SD) 35.0 (10.69) 35.6 (9.18) 35.3
(9.84)
- 77 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
Median 33.0 38.0 34.5
Min, Max 18,50 19,50 18,50
Baseline Height (cm) n 20 19 39
Mean (SD) 172.59 (10.853) 172.16
(8.631) 172.38 (9.707)
Median 169.75 170.10 170.10
Min, Max 155.9, 195.6 158.0, 188.0
155.9, 195.6
Baseline Weight (kg) n 20 19 39
Mean (SD) 74.13 (14.701) 71.35 (12.611)
72.77 (13.615)
Median 70.45 69.00 69.60
Min, Max 58.5, 110.0 55.0, 92.5 55.0,
110.0
[0310] The vaccine was administered in 0.1 ml intradermal injections followed
by EP at the
site of vaccination. EP was performed using CELLECTRAO 2000 with four 52-msec
pulses
at 0.2A (40 to 200 V, depending on tissue resistance) per season. The first
two pulses were
spaced 0.2 seconds apart followed by a 3-second pause before the final two
pulses that were
also spaced by 0.2 seconds. The dose groups were enrolled sequentially with a
safety run-in
for each. Participants were and will be evaluated clinically and for safety on
Day 1 and at
Weeks 1, 4 (Dose 2), 6, 8, 12, 28, 40 and 52. Safety laboratory testing
(complete blood count,
comprehensive metabolic panel and urinalysis) were and will be conducted on
all follow-up
visits except for Day 0, Day 1 and Week 4. Immunology specimens were obtained
at all time
points post-dose 1 except Day 1 and Week 1. Local and systemic AEs, regardless
of
relationship to the vaccine, were recorded and graded by the investigator. AEs
were graded
according to the Toxicity Grading Scale for Healthy Adult and Adolescent
Volunteers
Enrolled in Preventive Vaccine Clinical Trials guidelines that were issued by
the Food and
Drug Administration in September 2007.
103111 Vaccine Safety and Tolerability
[0312] 39 (97.5%) completed both doses and 1 subject in the 2.0 mg group
discontinued
trial participation prior to receiving the second dose due to lack of
transportation to the
clinical sites, unrelated to the study or the dosing. All 39 remaining
subjects completed the
visit 8 weeks post-dose 1. There were a total of 11 local and systemic AEs
reported by 8
weeks post-dose 1, six of these were deemed related to vaccine. All AEs were
mild or Grade
1 in severity. The most frequent AEs were injection site reactions including
injection site pain
(3) and erythema (2). One systemic AE related to the vaccine was nausea. There
were no
- 78 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
febrile reactions. No subjects discontinued the trial due to an AE. No serious
adverse events
(SAEs) nor AESIs were reported. There were no abnormal laboratory values of
clinical
concern throughout the initial 8-week follow-up period. There was no increase
in the number
of participants who experienced AEs related to the vaccine in the 2.0 mg group
(10% of
subjects), compared to that in the 1.0 mg group (15% of subjects). In
addition, there was no
increase in frequencies of AEs with the second dose over the first dose in
both dose level
groups. The INO-4800 Phase 1 safety data thus suggests that the vaccine is
likely a safe
booster as there was no increase frequency of side effects after the second
vaccine
administration compared to the first dose.
[0313] lmmunogenicity: Thirty-eight subjects were included in the
immunogenicity
analysis. In addition to one subject in the 2.0 mg group who discontinued
prior to completing
dosing, one subject in the 1.0 mg group was deemed seropositive at baseline
and was
excluded.
[0314] Humoral Immune Responses: Serum samples were used to measure
neutralizing
antibody titers against SARS-CoV-2/Australia/ VIC01/2020 isolate and binding
antibodies to
RBD and whole spike Si +S2 protein.
[0315] S 1+S2 Enzyme-Linked Immunosorbent Assay (ELISA): A standard binding
EL1SA was used to detect serum binding anti-SARS-CoV-2 spike antibodies. EL1SA
plates
were coated with recombinant Sl+S2 SARS-CoV-2 spike protein (Sino Biological)
and
incubated overnight and blocked. Samples were serially diluted and incubated
on the blocked
assay plates for one hour. The magnitude of the assay response was expressed
as titers which
were defined as the greatest serial dilution at which the optical density 3 SD
above
background Day 0. 68% of participants in the 1.0 mg group and 70% of
participants in the 2.0
mg group had at least an increase in serum IgG binding titers to Sl+S2 spike
protein when
compared to their pre-vaccination time point (Day 0), with the responder GMT
of 320.0 (95%
CI: 160.5, 638.1) and 508.0 (95% CI: 243.6, 1059.4) in the 1.0 mg and 2.0 mg
groups,
respectively (Figure 17C). In Figure 17D, the humoral response in the 1.0 mg
dose group
and 2.0 mg dose group was assessed for the ability to bind whole spike protein
(Si and S2)
(n=19, 1.0mg; n=19, 2.0 mg). End point titers were calculated as the titer
that exhibited an
OD 3.0 SD above baseline, titers at baseline were set at 1. A response to live
virus
neutralization was a PRNT IC50 > 10. In all graphs horizontal lines represent
the Median and
bars represent the Interquartile Range.
- 79 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0316] Sera was also tested for the ability to neutralize live virus in SARS-
CoV-2 wild-type
virus neutralization assays. SARS-CoV-2/Australia/ VIC01/2020 isolate
neutralization assays
were performed at Public Health England (Porton Down, UK). Neutralizing virus
titers were
measured in serum samples that had been heat-inactivated at 56 C for 30 min.
SARS-CoV-2
(AustraliaNIC01/2020 iso1ate44) was diluted to a concentration of 933 pfu m1-1
and mixed
50:50 in 1% FCS/MEM containing 25mM HEPES buffer with doubling serum
dilutions.
After 5 days incubation at 37 C in a humidified box, the plates were fixed,
stained and
plaques counted. Virus titer were determined using a standard 50% tissue
culture infection
dose (TCID50) assay. After the second vaccination at week 6, the responder
geometric mean
titer (GMT) by live virus PRNT 1050 neutralization assay were 82.4 and 63.5 in
the 1.0 mg
and 2.0 mg groups, respectively. The percentage of responders (post
vaccination PRNT 1050
> 10) were 83% and 84% in the 1.0 mg and 2.0 mg groups, respectively (Figure
17A and
Table 7).
[0317]
Table 7. Live SARS-CoV-2 Neutralization
1.0mg 2.0mg
N=18* N=19
Overall 44.4 (14.6,
Week 6 GMT Reciprocal Titer (95% CI) 134.8) 34.9 (15.8,
77.2)
Range 1,11647 1,652
Responders**
n (%) 15 (83%) 16 (84%)
Week 6 GMT Reciprocal Titer (95% CI) 82.4 (29.1, 63.5 (39.6,
101.8)
Range 233.3) 13 652
4, 11647
* Excludes one subject with baseline positive NP ELISA
** Week 6 PRNT IC so > 10, or >4 if binding ELISA activity is seen
[0318] RBD Enzyme-Linked Immunosorbent Assay (ELISA): MaxiSorp 96-well plates
(ThermoFisher, 439454) were coated with 5Oul/well of lug/ml of SARS-CoV-2 RBD
(SinoBiological, 40592-VO8H), protein diluted in PBS and incubated at 4oC
overnight.
Plates were washed 4 times with PBST (PBS with 0.05% Tween-20) and blocked
with
200u1/well of blocking buffer (PBS with 5% non-fat dry milk and 0.1% Tween-20)
at room
temperature for 2hr. After washing with PBST, 5Oul/well of sera sample
serially diluted in
blocking buffer was added to the plate in duplicate and incubated at room
temperature for
- 80 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
2hr. After washing with PBST, 5Oul/well of anti-human-IgG-HRP detection
antibody (BD
Pharmingen, 555788) diluted 500-fold in blocking buffer was added and
incubated at room
temperature for lhr. After washing with PBST, 5Oul/well of 1-Step Ultra TMB
(Thermo,
34028) was added and incubated at room temperature for 5min. 5Oul/well of 2M
sulfuric
acid was added to stop the color change reaction and optical absorbance was
measured at 450
and 570nm on a Synergy 2 microplate reader (Biotek). Endpoint titers were
defined as the
greatest serial dilution at which the 0D450-570 values were 3 standard
deviations above the
matched Day 0 signal. At week 6, the responder GMT were 385.6 (95% CI: 69.0,
2154.9) and
222.1 (95% CI: 87.0, 566.8) in the 1.0 mg and 2.0 mg groups, respectively
(Figure 17B).
[0319] Overall seroconversion (defined as those participants who respond with
neutralization or binding antibodies to S protein or RBD) after 2 vaccine
doses in 1.0 mg and
2.0 mg dose group were 89% and 95%, respectively.
[0320] Cellular Responses: Peripheral Blood Mononuclear Cells (PBMCs) were
isolated
from blood samples, frozen and stored in liquid nitrogen for subsequent
analyses.
[0321] INO-4800 SARS-CoV-2 Spike ELISPOT. Peripheral mononuclear cells (PBMCs)
were isolated pre- and post-vaccination. Cells were stimulated in vitro with a
pool of 15-mer
peptides (overlapping by 9 residues) spanning the full-length consensus spike
protein
sequence. Cells were incubated overnight (18-22h, 37C, 5% CO2) with peptide
pools
(225 g/m1), DMSO alone (0.5 %, negative control) or PMA and Ionomycin
(positive
controls). The next day, cells were washed off, and the plates were developed:
The detection
antibody is biotinylated and followed by a streptavidin-enzyme conjugate. By
using a
substrate with a precipitating rather than a soluble product, resulting in
visible spots. Each
spot corresponds to an individual cytokine-secreting cell. After plates were
developed, spots
were scanned and quantified using the CTL S6 Micro Analyzer (CTL) with
ImmunoCaptureTM and InimunoSpotTM software. Values are shown as background-
subtracted
average of measured triplicates.
[0322] The percentage of responders at week 8 was 74% in the 1.0 mg dose
group, and
100% in the 2.0 mg dose group (Table 8). The Median SFU per 106 PBMC was 46
and 71 for
the responders in 1.0 mg and 2.0 mg dose groups, respectively. In each group,
there were
statistically significant increases in the numbers of interferon-y--secreting
cells (SFU)
obtained per million PBMCs over baseline (P=0.001 and P<0.0001, respectively,
Wilcoxon
matched-pairs signed rank test, post-hoc analysis), Figure 18A. Interestingly,
5 non-
- 81 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
responders in 1.0 mg group by T cell ELISPot assay showed strong reactivity by
live virus
neutralization assay. It is also interesting to note that 3 convalescent
samples tested by the
ELISpot assay showed lower T cell responses, with a median of 33, than the 2.0
mg dose
group at Week 8. INO-4800 generated strong T cell responses that were more
frequent and a
higher responder median response (45.6 vs 71.1) in the 2.0 mg dose group. The
2.0 mg
group's T cell responses were mapped to 5 epitope pools as shown in Figure
18B.
Interestingly T cell responses in the all regions of the Spike protein were
observed.
[0323] Table 8. Immune Responses
1.0 mg Cohort 2.0 mg Cohort
Inunune Assay Output Value Responders n (Y.)
Output Value Responders2 n (%)
Neutralization 44.4 [14.6, 15/18 (83%) 34.9 115.8,
77.21 16/19 (84%)
Week 6 GMT 134.8] (1, (1,652)
Reciprocal Titer 11647)
[95% CI] (Range)
RED Binding 27.3 [4.8, 10/18 (56%) 66.8 [17.4,
257.5] 14/18 (78%)
Antibody Week 6 156.8] (1, (1,3125)
GMT Reciprocal 15625)
Titer [95% CI]
(Range)
SI+S2 Binding 174.4 [59.9, 17/19 (89%) 136.8 134.5,
543.1] 15/19 (79%)
Antibody Week 6 507.3] (1, 2560)
GMT Reciprocal (1, 2560)
Titer [95% CI]
(Range)
IFN-gamma 26.2 SFU [10- 14/19 (74%)'1 71 SFU [32-194]
19/19 (100%) /I
ELISpot Week 8 641 (8.9, 615.6)
Median SFU per (1, 374.4)
[95% C11 (Range)
1.0mg Cohort excludes one subject with baseline ELISA titer of 1280
Response criteria: Neutralization -Week 6 PRNT ICso > 10, or >4 if binding
ELISA
activity is seen RBD Binding -Week 6 value >1 ELISpot ¨ Value >12 SFU over
Week 0
1-` - Responders generated using Week 6 and Week 8 data
[0324] INO-4800 SARS-CoV-2 Spike Flow Cytometry Assay: The contribution of
CD4+
and CD8+ T cells to the cellular immune response against INO-4800 was assessed
by
- 82 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
intracellular cytokine staining (ICS). PBMCs were also used for Intracellular
Cytokine
Staining (ICS) analysis using flow cytometry. One million PMBCs in 200uL
complete RPMI
media were stimulated for six hours (37 C, 5% CO2) with DMSO (negative
control), PMA
and Ionomycin (positive control, 10Ong/mL and 2lig/mL, respectively), or with
the indicated
peptide pools (225ug/mL). After one hour of stimulation, Brefeldin A and
Monensin (BD
GolgiStop and GolgiPlug, 0.001% and 0.0015%, respectively) were added to block
secretion
of expressed cytokines. After stimulation the cells were moved to 4 C
overnight. Next, cells
were washed in PBS for live/dead staining (Life Technologies Live/Dead aqua
fixable
viability dye, as previously described), and then resuspended in FACS buffer
(0.5%BSA,
2mM EDTA, 20mM HEPES). Next, cells were stained for extracellular markers,
fixed and
permeabilized, and then stained for the indicated cytokines (Table 9) for
antibodies used for
flow cytometry.
[0325] Table 9: Flow Cytometry Panel
Tube Channel Marker/Cytokine
1 Unstained NA
2 BV510 Live/Dead Fix Aqua
3 BUV737 CDg
4 APC-CY7 IL-2
BV650 CD45RA
6 APC CD3
7 BV786 CD14/CD16/CD 19
8 BV711 TFN-ganmia
9 BV421 CCR7
PE-C.y7 IL-17
11 FITC FITC
12 PE Dazzle (PE-CF594) IL-4
13 PE CD107a
14 PerCP-eFluor710 (PerCP-Cy5.5) CD4
[0326] CD8+ T cells producing IFN-y, TNF-a and/or IL-2 (any response) were
statistically
significantly increased post vaccination in the 2.0 mg dose group (Figure 18C,
P=0.0181,
Wilcoxon matched-pairs signed rank test, post-hoc analysis). CD4+T cells
producing TNF- a
were also statistically significantly increased in the 2.0 mg dose group
(Figure 18C,
P=0.0020, Wilcoxon matched-pairs signed rank test, post-hoc analysis).
- 83 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0327] CD4+ and CD8+ T cells were explored following vaccination. Nearly half
(47%) of
the CD8+T cells in the 2.0 mg dose group were dual producing IFN-y and TNF-a
(Figure
18E). CD8+ T cells producing cytokine in the 1.0 mg dose group were primarily
monofunctional IFN-y producing cells. The CD4+ T cell compartment was highly
polyfunctional with 6% and 9% (in the 1.0 mg and 2.0 mg dose groups,
respectively)
producing all 3 cytokines, 1FN-y, TNF-a, and 1L-2.
[0328] The composition of CD4+ or CD8+ T cells producing any cytokine (any
response,
IFN-y or TNF-a or IL-2 following vaccination) was also assessed for surface
markers CCR7
and CD45RA to characterize effector (CCR7-CD45RA+), effector memory (CCR7-
CD45RA-), and central memory (CCR7+CD45RA-) cells (Figure 18D). In both dose
groups,
CD8+T cells making cytokine in response to stimulation with spike peptides
were balanced
across the three populations, whereas CD4+ T cells were predominantly of the
central
memory phenotype (Figure 18D).
[0329] Th2 responses were also measured by assessing 1L-4 production, and no
statistically
significant increases (Wilcoxon matched-pairs signed rank test, post-hoc
analysis) were
observed in either group post vaccination (Figure 18F).
[0330] In this Phase 1 trial, INO-4800 vaccination led to potent T cell
responses with
increased Thl phenotype, demonstrated by both 1FN-y EL1Spot as well as
multiparametric
flow cytometry, as evidenced by increased expression of Thl-type cytokines IFN-
y, TNF-a.
and IL-2 (Figure 18C). Assessment of polyfunctionality of T cells induced by
INO-4800
suggested the presence of SARS-CoV-2 specific CD4+ and CD8+ T cells exhibiting
hallmarks of memory status suggest that a persistent cellular response has
been established
(Figure 18D). Importantly, this was accomplished while minimizing induction of
IL-4, a
prototypical Th2 cytokine (Figure 18F).
[0331] PHASE 1 UPDATE
[0332] This was designed as a Phase 1, open-label, multicenter trial
(NCT04336410) to
evaluate the safety, tolerability and immunogenicity of INO-4800 administered
intradermally (ID) followed by electroporation using the CELLECTRA 2000
device.
Healthy participants 18 to 50 years of age without a known history of COVID-19
illness
received either a 1.0 mg or 2.0 mg dose of INO-4800 in a 2-dose regimen (Weeks
0 and
4).
- 84 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0333] DNA vaccine INO-4800. The vaccine was produced according to current
Good
Manufacturing Practices. INO-4800 contains plasmid pGX9501 expressing a
synthetic,
optimized sequence of the SARS-CoV-2 full length spike glycoprotein which was
optimized
as previously described at a concentration of 10 mg/ml in a saline sodium
citrate buffer.
[0334] Endpoints. Safety endpoints included systemic and local administration
site
reactions up to 8 weeks post-dose 1. Immunology endpoints include antigen-
specific binding
antibody titers, neutralization titers and antigen-specific interferon-gamma
(IFN-g) cellular
immune responses after 2 doses of vaccine. For Live Virus Neutralization, a
responder is
defined as Week 6 PRNT 1050> 10, or > 4 if a subject is a responder in ELTSA.
For Si +S2
EL1SA, a responder is defined as a Week 6 value > 1. For the EL1Spot assay, a
responder is
defined as a Week 6 or Week 8 value that is > 12 spot forming units per 106
PBMCs above
Week 0.
[0335] Study procedures.
[0336] Forty participants were enrolled into two groups; 20 participants in
each of 1.0 mg
and 2.0 mg dose groups that received their doses on Weeks 0 and 4. The vaccine
was
administered in 0.1 ml intradermal injections in the arm followed by EP at the
site of
vaccination. Subjects in the 1.0 mg dose group received one injection on each
dosing visit.
The second dose of the vaccine could be injected in the same arm or a
different arm relative
to the first dose. Subjects in the 2.0 mg dose group received one injection in
each arm at each
dosing visit. EP was performed using CELLECTRA 2000 as previously described.
The
device delivers total four electrical pulses, each 52 ms in duration at
strengths of 0.2 A
current and voltage of 40-200 V per pulse. The dose groups were enrolled
sequentially with a
safety run-in for each. The 1.0 mg dose group enrolled a single participant
per day for 3 days.
An independent Data Safety Monitoring Board (DSMB) reviewed the Week 1 safety
data and
based on a favorable safety assessment, made a recommendation to complete
enrollment of
the additional 17 participants into that dose group. In a similar fashion, the
2.0 mg dose group
was subsequently enrolled. Participants were assessed for safety and
concomitant
medications at all time points, including screening, Week 0 (Dose 1), post
dose next day
phone call, Week 1, 4 (dose 2), 6, 8, 12. 28, 40 and 52 post-dose 1. Local and
systemic AEs,
regardless of relationship to the vaccine, were recorded and graded by the
investigator. Safety
laboratory testing (complete blood count, comprehensive metabolic panel and
urinalysis)
- 85 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
were and will continue to be conducted at screening, Week 1, 6, 8, 12,28 and
52 post-dose 1.
Immunology specimens were obtained at all time points post-dose 1 except at
Day 1 and
Week 1. AEs were graded according to the Toxicity Grading Scale for Healthy
Adult and
Adolescent Volunteers Enrolled in Preventive Vaccine Clinical Trials
guidelines that were
issued by the Food and Drug Administration in September 2007. The DSMB
reviewed
laboratory and AE data for the participants up to 8 weeks included in this
report. There were
protocol-specified safety stopping rules and adverse events of special
interest (AESIs). For
the purpose of this report, clinical and laboratory safety assessments up to 8
weeks post the
first dose are presented.
[0337] Protocol eligibility. Eligible participants must have met the following
criteria:
healthy adults aged between 18 and 50 years; able and willing to comply with
all study
procedures; Body Mass Index of 18-30 kg/m2 at screening; negative serological
tests for
Hepatitis B surface antigen, Hepatitis C antibody and Human Immunodeficiency
Virus
antibody; screening electrocardiogram (ECG) deemed by the Investigator as
having no
clinically significant findings; use of medically effective contraception with
a failure rate of
<1% per year when used consistently be post-menopausal, or surgically sterile
or have a
partner who is sterile. Key exclusion criteria included the following:
individuals in a current
occupation with high risk of exposure to SARS-CoV-2;previous known exposure to
SARS-
CoV-2 or receipt of an investigational product for the prevention or treatment
of COVID-19;
autoimmune or immunosuppression as a result of underlying illness or
treatment;
hypersensitivity or severe allergic reactions to vaccines or drugs; medical
conditions that
increased risk for severe COVID-19;reported smoking, vaping, or active drug,
alcohol or
substance abuse or dependence; and fewer than two acceptable sites available
for intradermal
injection and electroporation.
[0338] Clinical Trial Population:
[0339] Healthy adult volunteers between the ages of 18-50 years, inclusive.
[0340] Inclusion Criteria:
a. Adults aged 18 to 50 years, inclusive:
b. Judged to be healthy by the Investigator on the basis of medical
history,
physical examination and vital signs performed at Screening;
- 86 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
c. Able and willing to comply with all study procedures;
d. Screening laboratory results within normal limits or deemed not
clinically
significant by the Investigator;
e. Negative serological tests for Hepatitis B surface antigen (HBsAg),
Hepatitis
C antibody and Human Immunodeficiency Virus (HIV) antibody screening;
Screening electrocardiogram (ECG) deemed by the Investigator as having no
clinically significant findings (e.g. Wolff-Parkinson-White syndrome);
g. Use of medically effective contraception with a failure
rate of < 1% per year
when used consistently and correctly from screening until 3 months following
last
dose, be post-menopausal, be surgically sterile or have a partner who is
sterile.
[0341] Exclusion Criteria:
a. Pregnant or breastfeeding, or intending to become pregnant or father
children
within the projected duration of the trial starting with the screening visit
until 3
months following last dose;
b. Is currently participating in or has participated in a study with an
investigational product within 30 days preceding Day 0;
c. Previous exposure to SARS-CoV-2 (laboratory testing at the
Investigator's
discretion) or receipt of an investigational vaccine product for prevention of
COVID-
19, MERS or SARS;
d. Current or history of the following medical conditions:
= Respiratory diseases (e.g., asthma, chronic obstructive pulmonary
disease);
= Hypertension, sitting systolic blood pressure >150 mm Hg or a diastolic
blood
pressure >95 mm Hg;
= Malignancy within 5 years of screening;
= Cardiovascular diseases (e.g., myocardial infarction, congestive heart
failure,
cardiomyopathy or clinically significant arrhythmias);
e. Immunosuppression as a result of underlying illness or
treatment including:
= Primary immunodeficiencies;
= Long term use (>7 days) of oral or parenteral glucocorticoids;
= Current or anticipated use of disease modifying doses of anti-rheumatic
drugs
and biologic disease modifying drugs;
- 87 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
= History of solid organ or bone marrow transplantation;
= Prior history of other clinically significant immunosuppressive or
clinically
diagnosed autoimmune disease.
Fewer than two acceptable sites available for ID injection and EP considering
the deltoid and anterolateral quadriceps muscles;
g. Any physical examination findings and/or history of any
illness that, in the
opinion of the study investigator, might confound the results of the study or
pose an
additional risk to the patient by their participation in the study.
[0342] Immunogenicity assessment methods.
[0343] Samples collected at screening, Week 0 (prior to dose) and at Weeks 6
and 8 were
analyzed. Peripheral Blood Mono-nuclear Cells (PBMCs) were isolated from blood
samples
by a standard overlay on ficoll hypaque followed by centrifugation. Isolated
cells were frozen
in 10% DMSO and 90% fetal calf serum. The frozen PBMCs were stored in liquid
nitrogen
for subsequent analyses. Serum samples were stored at -80 C until used to
measure binding
and neutralizing antibody titers.
[0344] SARS-CoV-2 wildtype virus neutralization assays.
[0345] SARS-CoV-2/Australia/VIC01/2020 isolate neutralization assays were
performed at
Public Health England (Porton Down, UK). Neutralizing virus titers were
measured in serum
samples that had been heat-inactivated at 56 C for 30 mm. SARS-CoV-2
(AustraliaNIC01/2020 iso1ate44) was diluted to a concentration of 933 pfu/m
land mixed
50:50 in 1% FCS/MEM containing 25 mM HEPES buffer with doubling serum
dilutions.
After a 1 h incubation at 37 C, the virus-antibody mixture was transferred to
confluent
monolayers of Vero E6 cells (ECACC 85020206; PHE, UK). Virus was allowed to
adsorb
onto cells at 37 C for a further hour in an incubator, and the cell monolayer
was overlaid
with MEM/4% FBS/1.5% CMC. After 5 days incubation at 37 C, the plates were
fixed,
stained, with 0.2% crystal violet solution (Sigma) in 25% methanol (v/v).
Plaques were
counted.
[0346] S1+ S2 enzyme-linked immunosorbent assay (ELISA).
[0347] ELISA plates were coated with 2.0mg/mL recombinant SARS-CoV-2 S1+S2
spike
- 88 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
protein (Acro Biosystems; SPN-052H8) and incubated overnight at 2-8 C. The
S1+S2
contains amino acids residues Val 16-Pro 1213 of the full length spike
protein, GenBank #
QHD43416.1.It contains two mutations to stabilize the protein to the trimeric
pre-fusion state
(R683A, R685A) and also contains a C-terminal 10xHis tag (SEQ ID NO: 24). The
plates
were then washed with PBS with 0.05% Tween-20 (Sigma; P3563) and blocked
(Starting
Block, Thermo Scientific;37,538) for 1-3 h at room temperature. Samples were
serially
diluted using blocking buffer and were added in duplicate, along with prepared
controls, to
the washed and blocked assay plates. The samples were incubated on the blocked
assay plates
for one hour at room temperature. Following sample and control incubation, the
plates were
washed and a 1/1000 preparation of anti-human IgGHRP con-jugate (BD
Pharmingen;
555,788) in blocking buffer was then added to each well and allowed to
incubate for 1 h at
room temperature. The plates were washed and TMB substrate (KPL; 5120-0077)
was then
added and allowed to incubate at room temperature for approximately 10 min.
TMB Stop
Solution (KPL; 5150-0021) was next added and the plates read at 450 nm and 650
nm on a
Synergy HTX Micro-plate Reader (BioTek). The magnitude of the assay response
was
expressed as titers which were defined as the greatest reciprocal dilution
factor of the greatest
dilution serial dilution at which the plate corrected optical density is 3 SD
above background
a subject's corresponding Week 0.
[0348] SARS-CoV-2 spike ELISpot assay.
[0349] Peripheral mononuclear cells (PBMCs) pre- and post-vaccination were
stimulated in
vitro with 15-mer peptides (overlapping by 9 residues) spanning the full-
length consensus
spike protein sequence. Cells were incubated overnight in an incubator with
peptide pools at
a concentration of 5mg per ml in a precoated ELISpot plate, (Mab-Tech, Human
IFN-g
ELISpot Plus). The next day, cells were washed off, and the plates were
developed via a
biotinylated anti-IFN-g detection antibody followed by a streptavidin-enzyme
conjugate
resulting in visible spots. Each spot corresponds to an individual cytokine-
secreting cell.
After plates were developed, spots were scanned and quantified using the CTL
S6 Micro
Analyzer (CTL) with Immuno-Capture and ImmunoSpot software. Values are shown
as the
background-subtracted average of measured triplicates. The ELISpot assay
qualification
determined that 12 spot forming units was the lower limit of detection. Thus,
anything above
this cutoff is considered to be a signal of an antigen specific cellular
response.
- 89 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
103501 INO-4800 SARS-CoV-2 spike flow cytometry assay.
[0351] PBMCs were also used for Intracellular Cytokine Staining (ICS)analysis
using flow
cytometry. One million PMBCs in 200mL complete RPMI media were stimulated for
six
hours (37 C, 5% CO2) with DMSO (negative control), PMA and Ionomycin
(positive
contro1,100 ng/mL and 2mg/mL, respectively), or with the indicated peptide
pools (225
Kg/mL). After one hour of stimulation, Brefeldin A and Monensin (BD GolgiStop
and
GolgiPlug, 0.001% and 0.0015%, respectively) were added to block secretion of
expressed
cytokines. After stimulation the cells were moved to 4 C overnight. Next,
cells were washed
in PBS for live/dead staining (Life Technologies Live/Dead aqua fixable
viability dye), and
then resuspended in FACS buffer (0.5%BSA, 2 mM EDTA, 20 mM HEPES). Next,
extracellular markers were stained, the cells were fixed and permeabilized
(eBioscienceTM
Foxp3Kit) and then stained for the indicated cytokines (Table 9) using
fluorescently
conjugated antibodies. Figs. 22A and B show representative gating strategies
for CD4+ and
CD8+ T cells as well as examples of positive expression of IFNI, TNFct, 1L-2
and 1L-4.
[0352] Statistical analysis.
[0353] No formal power analysis was applicable to this trial. Descriptive
statistics were
used to summarize the safety end-points: proportions with AEs, administration
site reactions,
and AESIs through 8 weeks. Descriptive statistics were also used to summarize
the
immunogenicity endpoints: median responses (with 95% confidence intervals) and
percentage of responders for cellular results, and geometric mean titers (with
95% confidence
intervals) and percentage of responders for humoral results. Post-hoc analyses
of post-
vaccination minus pre-vaccination paired differences in SARS-CoV-2
neutralization
responses (on the natural log-scale, with a paired t-test), ELISpot responses
(with Wilcoxon
signed-rank tests), and Intracellular Flow Assay responses (with Wilcoxon
signed-rank tests)
were performed.
[0354] Results
[0355] Study population demographics.
[0356] A total of 55 participants were screened and 40 participants were
enrolled into the
initial two groups (Figure 16). The median age was 34.5 years (range 18 to 50
years).
Participants were 55% (22/40) male (Table 6). Most participants were white
(82.5%, 33/40).
- 90 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0357] Vaccine safety and tolerability.
[0358] A total of 39 of 40 (97.5%) participants completed both doses; one
participant in the
2.0 mg group discontinued trial participation prior to receiving the second
dose due to lack of
transportation to the clinical sites, and discontinuation was unrelated to the
study or the
dosing (Figure 16). All 39 remaining subjects completed the visit 8 weeks post-
dose 1. There
was a total of 11 local and systemic adverse events (AEs) reported by 8 weeks
post-dose 1;
six of these were deemed related to vaccine (Table 10). All AEs were Grade 1
(mild) in
severity. Five of the six related AEs were injection site reactions including
injection site pain
(3) and erythema (2). One Grade 1 systemic AE related to the vaccine was
nausea. All related
AEs occurred on the dosing day when the subjects received the first or second
vaccination.
There were no febrile reactions and no antipyretic medicine was used post
vaccination. No
subject discontinued the trial due to an AE. No serious adverse events (SAEs)
nor adverse
events of special interest (AES1s) were reported. There were no abnormal
laboratory values
that were deemed clinically significant by the Investigators throughout the
initial 8-week
follow-up period. There was no increase in the number of participants who
experienced AEs
related to the vaccine in the 2.0 mg group (10%, 2/20), compared to that in
the 1.0 mg group
(15%, 3/20) (Figure 19). In addition, there was no increase in frequencies of
AEs with the
second dose over the first dose in both dose groups.
[0359] Table 10. Number of Adverse Events classified by MedDRA System Organ
Class,
severity, and investigator assigned relationship to study vaccination
MedDRA Severity Not related to Related to Total
number
System Organ vaccination vaccination
Class
Any system Mild 5 6 11
Organ Class Moderate
Severe
Gastrointestinal Mild 1 1 2
Disorders Moderate
Severe
Mild 5 5
- 91 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
General Moderate
Disorders and Severe
Administration
Site Conditions
Injury, Mild 2 2
Poisoning, and Moderate
Procedural Severe
Complications
Neoplasm Mild 1 1
Benign, Moderate
Malignant and Severe
Unspecified
Nervous System Mild 1 1
Disorders Moderate
Severe
[0360] lmmunogenicity.
[0361] Thirty-eight subjects were included in the immunogenicitv analyses. In
addition to
one subject in the 2.0 mg group who discontinued prior to completing dosing,
one subject in
the 1.0 mg group was deemed seropositive at baseline and was excluded. Data
for this subject
can be found in Table 11.
[0362] Table 11. Immune Responses for subject who was Sero-positive at
enrollment, 'NO-
4800 1.0 mg Dose Group
Immune Assay Output at Week 0 Output at Week 6
Neutralization Week 6 785 1089
Reciprocal Titer
RBD Binding Antibody 1 1
Week 6 Reciprocal Titer
S1+S2 Binding Antibody 1 14580
Week 6 Reciprocal Titer
- 92 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
IFN-gamma ELISpo1 Week 55.6 27.8
6 SFU/10^6 PBMC
[0363] Humoral immune responses.
[0364] Sera was tested for the ability to bind S1+S2 spike protein. 89%(17/19)
of
participants in the 1.0 mg group and 95% (18/19) of participants in the 2.0 mg
group had an
increase in serum IgG binding titers to Sl+S2 spike protein when compared to
their pre-
vaccination timepoint (Week 0), with the responder GMT of 655.5 (95%
CI:255.6,1681.0)
and 994.2(95% CI: 395.3, 2500.3) in the 1.0 mg and 2.0 mg groups, respectively
(Figure
17B, Figure 20 and Table 13). Sera was also tested for the ability to
neutralize live virus by
live virus PRNTIC50 neutralization assay. The geometric mean fold-rise at Week
6 relative
to baseline was 10.8 with a 95% CI of (4.4, 27.0) and 11.5 with a 95% CI of
(5.3, 24.9) in the
1.0 mg and 2.0 mg groups, respectively. In each group, there was a
statistically significant
increase at Week 6 over baseline (P<0.0001 paired t-test, post-hoc analysis),
Figure 17A. At
Week 6, the percentage of responders were 78% (14/18) and 84% (16/19) in the
1.0 mg and
2.0 mg groups, respectively (Figure 17A and Table 13), and the responder
geometric mean
titer (GMT) were 102.3 (95% CI: 37.4, 280.3) and 63.5 (95% CI: 39.6, 101.8) in
the 1.0 mg
and 2.0 mg groups, respectively. Overall seroconyersion (defined as those
participants who
respond with neutralization and/or binding anti-bodies to S protein) at Week 6
in 1.0 mg and
2.0 mg dose group were 95% (18/19) for each group (Table 13).
[0365] Enzyme-linked immunospot (ELISpot).
[0366] The percentage of responders at week 8 was 74% (14/19) in the1.0 mg
dose group,
and 100% (19/19) in the 2.0 mg dose group. These data taken with the
seroconversion data
result in a 100% (19/19) overall immune response in each group (Table 13,
Figures 18A and
21).The Median SFU per 106 PBMC was 46 (95% CI: 21.1, 142.2) and 71(95% CI:
32.2-
194.4) for the responders in 1.0 mg and 2.0 mg dose groups, respectively. The
median change
at week 8 relative to base-line was 22.3 (95% CI: 2.2, 63.4) and 62.8 (95% CI:
22.2, 191.1) in
the respective groups, and in each group, there were statistically significant
increases over
baseline (P= 0.001 and P<0.0001, respectively, Wilcoxon matched-pairs signed
rank test,
post-hoc analysis), Fig. 18A. It is also interesting to note that 3
convalescent samples (all 3
with symptoms but non-hospitalized), tested by the EL1Spot assay showed lower
T cell
- 93 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
responses, with a median of 33, than the 2.0 mg dose group at Week 8 (Figure
20). As shown
in Figures 18B and 18G, the 2.0 mg group's T cell responses were mapped to 5
epitope
pools. Encouragingly, T cell responses were seen in all regions of the spike
protein, with the
dominant pool encompassing the Receptor Binding Domain region, followed by
pools
covering the N Terminal Domain, as well as the Fusion Peptide, Heptad Repeat 1
and the
Central Helix.
[0367] Intracellular flow assay.
[0368] The contribution of CD4+and CD8+T cells to the cellular immune response
against
IN 0-4800 was assessed by intracellular cytokine staining (ICS). In the 2.0 mg
dose group,
the median change from baseline to Week 6 in CD8+T cells producing IFN-y, TNF-
a and/or
IL-2 (Any Response) was 0.11 with a 95% CI of (-0.02, 0.23); the change was
significantly
increased (P= 0.0181, Wilcoxon matched-pairs signed rank test, post-hoc
analysis). owing
chiefly to significant increases in IFN-y as well as TNF-ct production (Figure
18C). Also in
the 2.0 mg dose group, the median change from baseline to Week 6 in CD4+T
cells
producing TNF-ot was 0.02 with a 95% CI of (0.01 to 0.09); the change was also
significantly
increased (P= 0.0020, Wilcoxon matched-pairs signed rank test, post-hoc
analysis, Figure
18C).The composition of CD4+or CD8+T cells producing any cytokine (IFN-y or
TNF-a or
IL-2 following vaccination) was also assessed for surface markers CCR7 and
CD45RA to
characterize effector(CCR7-CD45RA+), effector memory (CCR7-CD45RA-), and
central
memory (CCR7+CD45RA-) cells (Figure 18D). In both dose groups, CD8+T cells
producing
cytokine in response to stimulation with SARS-CoV-2spike peptides were
generally balanced
across the three populations, whereas CD4+T cells were predominantly of the
central
memory phenotype (Figure 18D). CD4+and CD8+T cells following vaccination were
further
explored for their ability to produce more than one cytokine at a time and
were encouraged to
note that nearly half (41%) of the CD8+T cells in the 2.0 mg dose group were
dual producing
IFN-y and TNF-a (Figure 18E). CD8+T cells producing cytokine in the 1.0 mg
dose group
were primarily monofunctional IFN-y producing cells (57%). The CD4+T cell
compartment
was also polyfunctional in nature with 6%and 9%, in the 1.0 mg and 2.0 mg dose
groups,
respectively, producing all 3 cytokines, TNF-a, and IL-2 (Table 12).Th2
responses
were also measured by assessing IL-4 production, and no statistically
significant increases
(Wilcoxon matched-pairs signed rank test, post-hoc analysis) were observed in
either group
- 94 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
post vaccination (Figure 18F).
[0369] INO-4800 was well tolerated with a frequency of product-related Grade 1
AEs of
15% (3/20 subjects) and 10% (2/20 subjects) of the participants in 1.0 mg and
2.0 mg dose
group, respectively. Only Grade 1 AEs were noted in the study, which compares
favorably
with existing licensed vaccines. The safety profile of a successful COVID-19
vaccine is
important and supports broad development of INO-4800 in at-risk populations
who are at
more serious risk of complications from SARS-CoV-2 infection, including the
elderly and
those with comorbidities.INO-4800 also generated balanced humoral and cellular
immune
responses with all 38 evaluable participants displaying either or both
antibody or T cell
responses following two doses of IN 0-4800. Humoral responses measured by
binding or
neutralizing antibodies were observed in 95% (18/19) of the participants in
each dose group.
The neutralizing antibodies, measured by live virus neutralization assay, were
seen in 78%
(14/18) and 84% (16/19) of participants, and the corresponding GMTs were 102.3
1195% Cl
(37.4, 280.3)] and 63.5 1195% Cl (39.6, 101.8)] for the 1.0 mg and 2.0 mg dose
groups,
respectively. The range overlaps that of the PRNT IC50 titers reported from
convalescent
patients as well as the PRNT IC50 titers in NHPs which were protected in a
SARS-CoV-2
challenge. Furthermore, there was a statistically significant increase in
titers. It is important to
note that all but one vaccine recipient that did not develop neutralizing
antibody titers
responded positively in the T cell ELISpot assay, suggesting that the immune
responses
generated by the vaccine are registering differentially in these assays.
Cellular immune
responses were observed in 74% (14/19) and 100% (19/19) of 1.0 mg and 2.0 mg
dose
groups, respectively. Importantly, IN0-4800 generated T cell responses that
were more
frequent and with higher responder median responses (46 [95% CI (21.1, 142.2)]
vs. 711195%
CI (32.2,194.4)] SFU 106PBMC) in the 1.0 mg and 2.0 mg dose groups
respectively. These T
cell responses in the 2.0 mg dose group were higher in magnitude than
convalescent samples
tested (Figure 18A). Furthermore, there was a statistically significant
increase in SFU. In the
flow cytometric assays, both the 1.0 mg and 2.0 mg Dose Groups showed
increases in
cytokine production from both the CD4+ and CD8+ T cell compartments,
especially in the
2.0 mg group. The 2.0 mg group exhibited a number of statistically significant
cytokine
outputs, including IFN-y and TNF-a and -any cytokine" from the CD8+T cell
compartment
and TNF-a from the CD4+T cell compartment (Figure 18C).Of considerable
importance is
that CD8+T cell responses in the 2.0 mg dose group were dominated by cells
expressing both
- 95 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
IFN-y and TNF-a with or without IL-2 (Figure 18E and Table 12). In total,
these cells
amounted to nearly half of the total CD8+T cell response (42.7%, Table 12).
[0370] In this Phase 1 trial, IN0-4800 vaccination led to substantial T cell
responses with
increased Thl phenotype, measured by both IFN-y ELISpot as well as
multiparametric flow
cytometry, as evidenced by increased expression of Thl-type cytokines IFN-y,
TNF-a, and
1L-2 (Figure 18C). Assessment of cellular responses induced by IN 0-4800
displayed the
presence of SARS-CoV-2 specific CD4+ and CD8+ T cells exhibiting hallmarks of
differentiation into both central and effector memory cells, suggesting that a
persistent
cellular response has been established (Figure 1810). Importantly, this was
accomplished
while minimizing induction of 1L-4, a prototypical Th2 cytokine (Figure 18F),
supporting
that this vaccine has an immune phenotype, along with induction of protection
in preclinical
models, which makes it unlikely to be a risk for induction of enhanced
disease.
[0371] Table 12. Flow Cytometry Polyfunctionality
1.0 mg Cohort 2.0 mg Cohort
Parameter CD4 Cytokine CD8 Cytokine CD4 Cytokine CD8
Cytokine
Output Frequency (%) Frequency (%) Frequency (%) Frequency
(%)
IFN-gamma 31.2 56.7 29.5 27.1
only
INF-alpha only 20.4 14 20.9 11.2
IL-2 only 22.3 16.5 20.1 16.5
IFN-gamma and 8.0 9.7 6.7 40.6
TNF-alpha only
IFN-gamma and 2.1 0.9 0.6 1.3
1L-2 only
IL-2 and 9.6 0.7 13.5 1.2
TNF-alpha only
IFN-gamma and 6.4 1.5 8.7 2.1
IL-2 and
INF-alpha
Percents listed are the contributions of each output to the total cytokine
response
- 96 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0372] Table 13.
1.0 mg Cohort 2.0 mg Cohort
Immune Assay Overall Responder Responders* Overall Responder Responders*
Value Value n (%) Value Value
n (%)
Neutralization 44.4 102.3 14/18 34.9 63.5
16/19
Week 6 GMT [14.6, [37.4, (78%) [15.8, [39.6,
(84%)
Reciprocal Titer 134.81 280.3] 77.2] 101.81
[95% CI] (1, (13, (1,652) (13652)
(Range) 11647) 11647)
S1+S2 Binding 331.2 655.5 17/19 691.4 994.2
18/19
Antibody Week [91.2, [255.6, (89%) [217.5, [395.3,
(95%)
6 GMT 1203.2 168.1] 2197.21 2500.3]
Reciprocal Titer 1 (20, (1, (20,
[95% CI] (1, 14580) 14580) 14580)
(Range) 14580)
Total N/A N/A 18/19 N/A N/A
18/19
Seroconversion (95%)
(95%)
(Response in
Sl+S2 or
Neutralization)
IFN-gamma 26.2 45.6 14/19 71 71 SFU
19/19
ELISpot Week SFU [21.1, (74%) li SFU [32.2-
(100%)11
8 Median SFU [10.0- 142.2] [32.2- 194.41
per [95% CI] 64.41 (16.7, 194.41 (8.9,
(Range) (1, 374.4) (8.9, 615.6)
374.4) 615.6)
Overall N/A N/A 19/19 N/A N/A
19/19
Immune (100%)
(100%)
Response Rate
(Seroconversio
n or ELISpot)
1.0mg Cohort excludes one subject with baseline positive NP ELISA
- 97 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
Response criteria: Live Neutralization -Week 6 PRINT IC50> 10, or >4 if
binding
ELISA activity is seen; S1+S2 Binding¨Week 6 Value>1; RBD Binding -Week 6
value >1;
ELISpot ¨ Value >12 SFU over Week 0
1-` - Responders generated using Week 6 or Week 8 data
[0373] EXPANDED PHASE I STUDY
[0374] Approximately 120 healthy volunteers will be evaluated across three (3)
dose levels
(Study Groups). A total of 40 subjects will be enrolled into each Study Group.
Enrollment
into each Study Group will be stratified by age; n=20 for 18-50 years, n=10
for 51-64 years,
and n=10? 65 years (Table 14).
[0375] Subjects will be adults aged at least 18 years; judged to be healthy by
the
Investigator on the basis of medical history, physical examination and vital
signs performed
at Screening; able and willing to comply with all study procedures; screening
laboratory
results within normal limits for testing laboratory or deemed not clinically
significant by the
Investigator, Body Mass Index of 18-30 kg/m2, inclusive, at Screening,
negative serological
tests for Hepatitis B surface antigen (HBsAg), Hepatitis C antibody and Human
Immunodeficiency Virus (HIV) antibody at screening; screening ECG deemed by
the
Investigator as having no clinically significant findings (e.g. Wolff-
Parkinson-White
syndrome); and must meet one of the following criteria with respect to
reproductive capacity:
women who are post-menopausal as defined by spontaneous amenorrhea for? 12
months;
surgically sterile or have a partner who is sterile; use of medically
effective contraception.
Exclusion criteria are as follows: pregnant or breastfeeding, or intending to
become pregnant
or father children within the projected duration of the trial starting with
the screening visit
until 3 months following last dose; positive serum pregnancy test during
screening or positive
urine pregnancy test prior to dosing; currently participating in or has
participated in a study
with an investigational product within 30 days preceding Day 0; previous
exposure to severe
acute respiratory syndrome coronavirus 2 (SARS-CoV-2) or receipt of an
investigational
product for the prevention or treatment of COV113-19, middle east respiratory
syndrome
(MERS), or severe acute respiratory syndrome (SARS); in a current occupation
with high risk
of exposure to SARS-CoV-2 (e.g., health care workers or emergency response
personnel
having direct interactions with or providing direct care to patients); current
or history of
respiratory disease, hypersensitivity or severe allergic reactions to vaccines
or drugs,
- 98 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
diagnosis of diabetes mellitus, hypertension, malignancy within 5 years of
screening, or
cardiovascular disease; immunosuppression as a result of underlying illness or
treatment,
including primary immunodeficiencies, long term use (>7 days) of oral or
parenteral
glucocorticoids, current or anticipated use of disease-modifying doses of anti-
rheumatic
drugs and biologic disease-modifying drugs, history of solid organ or bone
marrow
transplantation, and prior history of other clinically significant
immunosuppressive or
clinically diagnosed autoimmune disease; fewer than two acceptable sites
available for ID
injection and EP considering the deltoid and anterolateral quadriceps muscles;
or reported
smoking, vaping, or active drug, alcohol or substance abuse or dependence; or
any physical
examination findings and/or history of any illness that, in the opinion of the
study
investigator, might confound the results of the study or pose an additional
risk to the patient
by their participation in the study.
[0376] All subjects will receive dosing on Day 0 and Week 4 (Table 15).
Subjects who
consent to receive the booster dose (Table 16) will receive the booster dose
no earlier than
Week 12 in their dosing schedule with the same dose previously received for
their two-dose
regimen (Day 0 and Week 4). Safety and immunogenicity will be evaluated at 2
weeks
following the booster dose.
[0377] Table 14:
Study Number Number Age Dosing 'NO- No. INO-
Total
Group Total Subjects (years) Weeks 4800 Injections/EP 4800
'NO-
Subjects by Age Dose per per Dosing Dose
per 4800
injection Visit Dosing
Dose
Visit
1 40 20* 18-50 0,4 ( 5 1.0 mg 1
1.0 mg 3.0 mg
51-64 days),
10 >65 Optional
Booster
2 40 20* 18-50 0,4 (1 5 1.0 mg 2a
2.0 mg 6.0 mg
10 51-64 days),
10 >65 Optional
Boostcrb
3 40 20 18-50 0,4 (1 5 0.5 mg 1
0.5 mg 1.5 mg
10 51-64 days),
- 99 ¨
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
>65 Optional
Booster'
Total 120 * Base Study (Others in expanded study)
alN0-4800 will be injected ID followed by EP in an acceptable location on two
different
limbs at each dosing visit
bOptional booster dose delivered no earlier than Week 12 in their dosing
schedule with the
same dose previously received for their two-dose regimen.
[0378] Subjects not receiving an optional booster dose will be followed to the
End of Study
(EOS) visit at Week 52 will be the End of Study (EOS) visit (Table 15). For
subjects
receiving an optional booster dose, the 48 Week Post-Booster Dose Visit will
be the EOS
visit (Table 16).
[0379] Primary Objectives:
= Evaluate the tolerability and safety of INO-4800 administered by ID
injection
followed by EP in healthy adult volunteers
= Evaluate the cellular and humoral immune response to INO-4800
administered by ID
injection followed by EP
[0380] Primary Safety Endpoints:
= Incidence of adverse events by system organ class (SOC), preferred term
(PT),
severity and relationship to investigational product. Percentage of
Participants with Adverse
Events (AEs) [Time Frame: Baseline up to Week 52 (if not receiving an optional
booster
dose) or the 48 Week Post-Booster Dose Visit (if receiving an optional booster
dose)].
= Administration (i.e., injection) site reactions (described by frequency
and severity).
Percentage of Participants with Administration (Injection) Site Reactions
[Time Frame: Day 0 up to Week 52 (if not receiving an optional booster dose)
or the 48
Week Post-Booster Dose Visit (if receiving an optional booster dose)].
= Incidence of adverse events of special interest. Percentage of
Participants with
Adverse Events of Special Interest (AESIs). [Time Frame: Baseline up to Week
52 (if not
receiving an optional booster dose) or the 48 Week Post-Booster Dose Visit (if
receiving an
optional booster dose)].
[0381] Primary Immunogenicity Endpoints:
- 100 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
= SARS-CoV-2 Spike glycoprotein antigen-specific antibodies by binding
assays.
Change from Baseline in SARS-CoV-2 Spike Glycoprotein Antigen-Specific Binding
Antibody Titers [Time Frame: Baseline up to Week 52 (if not receiving an
optional booster
dose) or the 48 Week Post-Booster Dose Visit (if receiving an optional booster
dose)].
= Antigen-specific cellular immune response by IFN-gamma ELISpot and/or
flow
cytometry assays. Change from Baseline in Antigen-Specific Cellular Immune
Response
Time Frame: Baseline up to Week 52 (if not receiving an optional booster dose)
or the 48
Week Post-Booster Dose Visit (if receiving an optional booster dose)].
[0382] Exploratory Objectives:
= Evaluate the expanded immunological profile by assessing both T and B
cell immune
response
= Evaluate the safety and immunogenicitv of an optional booster dose of INO-
4800
administered by ID injection followed by EP subsequent to a two-dose regimen
Exploratory Endpoints:
= Expanded immunological profile which may include (but not limited to)
additional
assessment of T and B cell numbers, neutralization response and T and B cell
molecular
changes by measuring immunologic proteins and mRNA levels of genes of interest
at all
weeks as determined by sample availability
= Incidence of all adverse events subsequent to an optional booster dose of
INO-4800
administered by ID injection followed by EP
= SARS-CoV-2 Spike glycoprotein antigen-specific neutralizing and binding
antibodies
subsequent to an optional booster dose of INO-4800 administered by ID
injection followed
by EP
= Antigen-specific cellular immune response by IFN-T ELISpot and/or flow
cytometry
subsequent to an optional booster dose of INO-4800 administered by ID
injection followed
by EP
[0383] Safety Assessment. Subjects will be followed for safety for the
duration of the trial
through EOS or the subject's last visit. Adverse events will be collected at
every visit
(including the Day 1 and 36 Week Post-Booster Dose phone calls). Laboratory
blood and
urine samples will be drawn according to the Schedule of Events (Table 15 and
Table 16).
- 101 -
CA 03168353 2022- 8- 17

n
>
o
u,
,
c 5)
oD
...
U'
u,
r.,
o
r.,
'.'
9'
"
,
0
l=.)
[0384] TABLE 15 - NON-BOOSTER CLINICAL TRIAL SCHEDULE OF EVENTS
=
t.)
-
,
Week 4 Zi
w
Day 0 Day 1 Week 1 Week 6 Week 8
Week 12 Week 28 Week 40 Week 52 ofs
Tests and assessments Screena
(+1d) 3d) 5d) 5d)
5d) 5d) (+5(1) 5d) ,.co
Pre Post Pre Post
Informed Consent X
Inclusion/Exclusion Criteria X
Medical History X X
Demographics X
Concomitant Medications X X X X X X
X X X X
Physical Exam' X X X X X X
X X X X
Vital Signs X X X X X X
X X X X
Height and Weight X
CBC with Differential X X X X
X X X X
Chemistry X X X X
X X X X
i
.-, HIV, HBV, HCV Serology' .. X
o
t\.) SARS-CoV-2 Serology X
,
12-lead ECG X
Urinalysis Routine' X X X X
X X X X
Pregnancy Testf X X X
INO-4800 + EP g X'' Xi'
Download EP Data' X X
Adverse Events X X X Xk X X X X X
X X X X
Immunology (Whole blood)' X X X X X
X X X X
Immunology (Serum)11' X X X X X
X X X X
-d
n
-i
=;=1--
cp
t.,
=
L.,
¨
=====
'
a
a
t.)

CI
0
OD
r*1.'
0
Table 15 (continued)
a. Screening assessment occurs from -30 days to -1 day prior to Day O.
b. Full physical examination at screening and Week 52 (or any other study
discontinuation visit) only. Targeted physical exam at all other visits.
oo
c. Includes Na. K, Cl, HCO3, Ca, PO4, glucose, BUN, Cr, AST, ALT and TBili.
d. HIV antibody or rapid test, BiBsA,g, HCV antibody.
e. Dipstick for glucose, protein, and hematuria. Microscopic examination
should be performed if dipstick is abnormal.
f. Serum pregnancy test at screening. Urine pregnancy test at other visits.
g. All doses delivered via intrademtal injection followed by EP.
h. For Study Groups Groups 1 and 3, one injection in skin preferably over
deltiod muscle at Day 0 and Week 4. For Study Group 2, two injections in skin
with each injection over a different deltoid or lateral
quadriceps; preferably over the deltoid muscles, at Day 0 and Week 4.
i. Following administration of IN0-4800+ER EP data will be downloaded from
the CELLECTRA 2000 device and provided to Inovio.
j. Includes AEs from the time of consent and all injection site reactions
that qualify as an AE.
k. Follow-up phone call to collect AE3.
1. 4 x 8.5 mL (34 mL) whole blood in 10 mL Acid Citrate Dextrose
(ACD, Yellow tap) tubes per time point. Note: Collect a total of 68 mL whole
blood prior to 1st dose (screening and prior to Day 0 dosing).
m. 1 x 8 mL blood in 10 mL red top serum collection tube per time
point. Note: Collect four aliquots of 1 mL each (total 4 mL) serum at each
time point prior to 1st dose (Screening and prior to Day 0 dosing).
(4J

CI
0
La
OD
0
[0385] Table 16 ¨ Booster Clinical Trial Schedule of Events
B 2 Week 12 Week 24 Week 36
Week 48 Week Post-
ooster Dose
Post-Booster Post-Booster Post-
Booster Post-Booster Booster Dose
Tests and assessments Visit
Dose Visit Dose Visit Dose Visit
Dose Phone Visit
Pre Post ( 5d) ( 5d) ( 5d) Call (+5d) ( 5d)
Concomitant Medications X X X X
X
Physical Exam' X X X X
X
Vital Signs X X X X
X
CBC with Differential X X X X
X
Chemistry') X X X X
X
Urinalysis Routine' X X X X
X
Pregnancy Testd X
4. IN 0-4800 + EP' Xf
Download EP Data X
Adverse Events') X X X X X Xi
X
Immunology (Whole bloody X X X X
X
Immunology (Semm)k X X X X
X
a. Full physical examination at the 48 Week Post-Booster Dose Visit (or any
other study discontinuation visit) only. Targeted physical exam at all other
visits.
b. Includes Na, K, Cl, HCO3, Ca, PO4, glucose, BUN, Cr, AST, ALT and TBili.
c. Dipstick for glucose; protein, and hematuria. Microscopic examination
should be performed if dipstick is abnormal.
d. Urine pregnancy test must be negative prior to receiving booster dose.
e. All doses delivered via intradermal injection followed by EP.
f. For Study Groups I and 3, one injection in skin preferably over deltiod
muscle (or alternatively, lateral quadriceps) at the Booster Dose Visit. For
Study Group 2, two injections in
skin with each injection over a different deltoid or lateral quadriceps;
preferably over the deltoid muscles, at the Booster Dose Visit.
g. Following administration of INO-4800+EP, EP data will be downloaded from
the CELLECTRA 2000 device and provided to Inovio.
k Includes Abs from the
time of consent and all injection site reactions that qualify as an AE.
i. Follow-up phone call to collect AEs.
j. 4 x 8.5 inL (34 nili) whole blood in 10 inL Acid Citrate Dextrose (ACD,
Yellow top) tubes per time point.
k. 1 x 8 mL blood in 10 ml red top serum collection tube per time point.

WO 2021/173829
PCT/US2021/019662
[0386] Immunogenicity Assessment. Immunology blood samples will be collected
according to the Schedule of Events (Table 15 and Table 16). Determination of
analysis of
collected samples for immunological endpoints will be determined on an ongoing
basis
throughout the study.
[0387] INO-4800 delivered ID followed by EP using CELLECTRA 2000 in healthy
volunteers is expected to be well tolerated, exhibit an acceptable safety
profile, and result in
generation of immune responses to SARS-CoV-2 Spike glycoprotein.
[0388] Example 7 Phase 2/3 Randomized, Blinded, Placebo-Controlled Trial to
Evaluate the Safety, Immunogenicity, and Efficacy of INO-4800, A Prophylactic
Vaccine Against COVID-19 Disease, Administered Intradermally Followed by
Electroporation (EP) in Healthy Seronegative Adults at High Risk of SARS-CoV-2
Exposure
[0389] This is a Phase 2/3, randomized, placebo-controlled, multi-center trial
to evaluate
the safety, immunogenicity and efficacy of INO-4800 administered by
intradermal (ID)
injection followed by electroporation (EP) using CELLECTRA 2000 device to
prevent
COVID-19 disease in participants at high risk of exposure to SARS-CoV-2. The
Phase 2
segment will evaluate immunogenicity and safety in approximately 400
participants at two
dose levels across three age groups. Safety and immunogenicity information
from the Phase 2
segment will be used to determine the dose level for the Phase 3 efficacy
segment of the
study involving approximately 6178 participants.
[0390] Table 17.
Arm lIntervention/treatment
........................................... ¨4.-
Experimental Phase 2: INO-4800 Dose Drug: INO-4800
Group 1 INO-4800 will be
administered
Participants will receive one ID on Day 0 and Day 28.
intradermal (ID) injection of 1.0
milligram (mg) of INO-4800 Device: CELLECTRA 2000
followed by electroporation (EP) EP using the CELLECTRA
using the CELLECTRA 2000 2000 device will be
administered
device on Day 0 and Day 28. following ID delivery of
'NO-
4800 on Day 0 and Day 28.
Experimental: Phase 2: INO-4800 Dose_ Drug: INO-4800
Group 2 INO-4800 will be
administered
- 105 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
Participants will receive two ID ID on Day 0 and Day 28.
injections of 1.0 mg (total 2.0 mg per Device: CELLECTRA 2000
dosing visit) of INO-4800 followed by EP using the CELLECTRA
EP using the CELLECTRA 2000 2000 device will be
administered
device on Day 0 and Day 28. following ID delivery of
INO-
4800 on Day 0 and Day 28.
Placebo Comparator: Phase 2: Placebo Drug: Placebo
Dose Group 1 Sterile saline sodium
citrate .. 1
Participants will receive one ID (SSC) buffer (SSC-0001)
will be
injection of placebo followed by EP administered ID on Day 0
and
using the CELLECTRAk 2000 device Day 28.
on Day 0 and Day 28. Other Names:
= SSC-0001
I Device: CELLECTRA 2000
EP using the CELLECTRA
2000 device will be administered
following ID delivery of sterile
saline sodium citrate (SSC) buffer
(SSC-0001) on Day 0 and Day
28.
Placebo Comparator: Phase 2: Placebo Drug: Placebo
Dose Group 2 Sterile saline sodium
citrate
Participants will receive two ID (SSC) buffer (SSC-0001)
will be
injections of placebo followed by EP administered ID on Day 0
and
using the CELLECTRA 2000 device Day 28.
on Day 0 and Day 28. Other Names:
= SSC-0001
Device: CELLECTRA 2000
EP using the CELLECTRA
2000 device will be administered
following ID delivery of sterile
saline sodium citrate (SSC) buffer
(SSC-0001) on Day 0 and Day
28.
: Experimental: Phase 3: INO-4800 Drug: INO-4800
Optimum Dose INO-4800 will be
administered
Participants will receive either one or ID on Day 0 and Day 28.
two 1.0 mg ID injections of INO-4800 Device: CELLECTRA 2000
based on results from Phase 2 EP using the CELLECTRA
segment, followed by EP using the 2000 device will be
administered
CELLECTRA 2000 device on Day 0 following ID delivery of
MO-
and Day 28. 4800 on Day 0 and Day 28.
- 106 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
Placebo Comparator: Phase 3: Placebo Drug: Placebo
Optimum Dose Sterile saline sodium
citrate
= Participants will receive
either one or (SSC) buffer (SSC-0001) will be
two ID injections of placebo based on administered ID on Day 0
and
= results from Phase 2
segment, Day 28.
followed by EP using the Other Names:
CELLECTRA 2000 device on Day 0 = SSC-0001
and Day 28.
Device: CELLECTRA 2000
EP using the CELLECTRA
2000 device will be administered
= following ID delivery of sterile
saline sodium citrate (SSC) buffer
= (SSC-0001) on Day 0 and Day
28.
103911 Primary Outcome Measure:
1. Phase 2: Change From Baseline in Antigen-specific Cellular Immune Response
Measured
by Interferon-gamma (IFN-y) Enzyme-linked Immunospot (ELISpot) Assay
[Time Frame: Baseline up to Day 3931
2. Phase 2: Change From Baseline in Neutralizing Antibody Response Measured by
a
Pseudovirus-based Neutralization Assay [Time Frame: Baseline up to Day 3931
3. Percentage of Participants With Virologically Confirmed COVID-19 Disease
[Time Frame: From 14 days after completion of the 2-dose regimen up to 12
months post-
dose 2 (i.e. Day 42 up to Day 393)]
103921 Secondary Outcome Measures:
1. Phase 2 and 3: Percentage of Participants with Unsolicited
and Solicited Injection Site
Reactions
[Time Frame: From time of consent up to 28 days post-dose 2 (up to Day 56)]
/. Phase 2 and 3: Percentage of Participants with Solicited and
Unsolicited Systemic
Adverse Events (AEs) [Time Frame: From time of consent up to 28 days post-dose
2 (up to
Day 56)]
3. Phase 2 and 3: Percentage of Participants with Serious
Adverse Events (SAEs)
[Time Frame: Baseline up to Day 3931
4. Phase 2 and 3: Percentage of Participants with Adverse Events of Special
Interest
(AESIs) [Time Frame: Baseline up to Day 3931
- 107 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
5. Phase 3: Percentage of Participants With Death from All Causes [Time
Frame:
Baseline up to Day 3931
6. Phase 3: Percentage of Participants With Non-Severe COVID-19 Disease
[Time
Frame: From 14 days after completion of the 2-dose regimen up to 12 months
post-dose 2
(i.e. Day 42 up to Day 393)]
7. Phase 3: Percentage of Participants With Severe COVID-19 Disease [Time
Frame:
From 14 days after completion of the 2-dose regimen up to 12 months post-dose
2 (i.e. Day
42 up to Day 393)]
8. Phase 3: Percentage of Participant With Death from COVID-19 Disease
[Time
Frame: From 14 days after completion of the 2-dose regimen up to 12 months
post-dose 2
(i.e. Day 42 up to Day 393)]
9. Phase 3: Percentage of Participants With Virologically-Confirmed SARS-
CoV-2
Infections [Time Frame: From 14 days after completion of the 2-dose regimen up
to 12
months post-dose 2 (i.e. Day 42 up to Day 393)]
10. Phase 3: Days to Symptom Resolution in Participants With COVID-19
Disease
[Time Frame: From 14 days after completion of the 2-dose regimen up to 12
months post-
dose 2 (i.e. Day 42 up to Day 393)]
11. Phase 3: Change From Baseline in Antigen-specific Cellular Immune Response
Measured by IFN-gamma ELISpot Assay [Time Frame: Baseline up to Day 3931
12. Phase 3: Change From Baseline in Neutralizing Antibody Response Measured
by a
Pseudovirus-based Neutralization Assay [Time Frame: Baseline up to Day 3931
[0393] Eligibility Criteria
Ages Eligible for Study: 18 Years and older
Sexes Eligible for Study: All
Gender Based: No
Accepts Healthy Volunteers: Yes
103941 Key Inclusion Criteria:
= Working or residing in an environment with high risk of exposure to SARS-
CoV-2
for whom exposure may be relatively prolonged or for whom personal protective
equipment
(PPE) may be inconsistently used, especially in confined settings
- 108 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
= Screening laboratory results within normal limits for testing laboratory
or are deemed
not clinically significant by the Investigator.
= Be post-menopausal or be surgically sterile or have a partner who is
sterile or use
medically effective contraception with a failure rate of < 1% per year when
used consistently
and correctly from screening until 3 months following last dose.
[0395] Key Exclusion Criteria:
= Acute febrile illness with temperature > 100.4 F (38.0 C) or acute onset
of upper or
lower respiratory tract symptoms (e.g., cough, shortness of breath, sore
throat).
= Positive serologic or molecular (Reverse transcription polymerase chain
reaction [RT-
PCR]) test for SARS-CoV-2 at Screening
= Pregnant or breastfeeding or intending to become pregnant or intending to
father
children within the projected duration of the trial starting from the
screening visit until 3
months following the last dose.
= Known history of uncontrolled HIV based on a CD4 count less than 200
cells per
cubic millimeter (imna^3) or a detectable viral load within the past 3 months.
= Is currently participating or has participated in a study with an
investigational product
within 30 days preceding Day 0.
= Previous receipt of an investigational vaccine for prevention or
treatment of COVID-
19, middle east respiratory syndrome (MERS), or severe acute respiratory
syndrome (SARS)
(documented receipt of placebo in previous trial would be permissible for
trial eligibility).
= Respiratory diseases (e.g., asthma, chronic obstructive pulmonary
disease) requiring
significant changes in therapy or hospitalization for worsening disease during
the 6 weeks
prior to enrollment.
= Immunosuppression as a result of underlying illness or treatment
= Lack of acceptable sites available for ID injection and EP
= Blood donation or transfusion within 1 month prior to Day 0.
= Reported alcohol or substance abuse or dependence, or illicit drug use
(excluding
marijuana use).
= Any illness or condition that in the opinion of the investigator may
affect the safety of
the participant or the evaluation of any study endpoint.
- 109 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0396] Example 8 One or two dose regimen of the SARS-CoV-2 DNA vaccine INO-
4800 protects against respiratory tract disease burden in nonhuman primate
(NHP)
challenge model
[0397] The safety, immunogenicity and efficacy of the intradermal delivery of
INO-4800, a
synthetic DNA vaccine candidate encoding a SARS-CoV-2 spike antigen, was
evaluated in
the rhesus macaque model. Single and two dose vaccination regimens were
evaluated.
Vaccination induced both binding and neutralizing antibodies, along with IFN-y-
producing T
cells against SARS-CoV-2. A high dose of SARS-CoV-2 Victoria01 strain (5 x
10^6 pfu)
was used to specifically assess the impact of INO-4800 vaccination on lung
disease burden to
provide both vaccine safety and efficacy data. A broad range of lower
respiratory tract
disease parameters were measured by applying histopathology, lung disease
scoring metric
system, in situ hybridization, viral RNA RT-PCR and computed tomography (CT)
scans to
provide an understanding of the impact of vaccine induced immunity on
protective efficacy
and potential vaccine enhanced disease (VED).
[0398] This example describes the immunogenicity, efficacy and safety
assessment of the
SARS-CoV-2 DNA vaccine INO-4800 in a stringent high dose nonhuman primate
challenge
model. Intradermal delivery of 1 mg of INO-4800 to rhesus macaques induces
humoral and T
cell responses against the SARS-CoV-2 spike antigen in both a 2-dose regimen
and a
suboptimal 1 dose regimen. Throughout the study no overt clinical events were
recorded in
the animals. After a high dose SARS-CoV-2 challenge, a reduction in viral
loads was
observed and lung disease burden in both the 1 and 2 dose vaccine groups
supporting the
efficacy of INO-4800. Importantly, vaccine enhanced disease (VED) was not
observed, even
with the 1 dose group.
[0399] Methods:
104001 Vaccine. The optimized DNA sequence encoding SARS-CoV-2 IgELS-spike was
created using Inovio's proprietary in silico Gene Optimization Algorithm to
enhance
expression and immunogenicity. The optimized DNA sequence was synthesized,
digested
with BamHI and XhoI, and cloned into the expression vector pGX0001 under the
control of
the human cytomegalovirus immediate-early promoter and a bovine growth hormone
polyadenylation signal.
[0401] Animals. Eighteen rhesus macaques of Indian origin (Macaca mulatta)
were used in
this study. Study groups comprised three males and three females of each
species and all
were adults aged between 2.5 and 3.5 years of age and weighing > 4 Kg at time
of challenge.
- 110 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
Prior to the start of the experiment, socially compatible animals were
randomly assigned to
challenge groups, to minimize bias. Animals were housed in compatible social
groups, in
cages in accordance with the UK Home Office Code of Practice for the Housing
and Care of
Animals Bred, Supplied or Used for Scientific Procedures (2014) and National
Committee
for Refinement, Reduction and Replacement (NC3Rs) Guidelines on Primate
Accommodation, Care and Use, August 2006. Housing prior and for the duration
of challenge
is described in 1Sa1guero, F.J., et al., Comparison of Rhesus and Cynomolgus
macaques as an
authentic model for COVID-19. bioRxiv, 2020: p. 2020.09.17.301093.1. All
experimental
work was conducted under the authority of a UK Home Office approved project
license
(PDC57C033) that had been subject to local ethical review at PHE Porton Down
by the
Animal Welfare and Ethical Review Body (AWERB) and approved as required by the
Home
Office Animals (Scientific Procedures) Act 1986. Animals were sedated by
intramuscular
(IM) injection with ketamine hydrochloride (Ketaset, 100mg/ml, Fort Dodge
Animal Health
Ltd, Southampton, UK; 10mg/kg) for procedures requiring removal from their
housing. None
of the animals had been used previously for experimental procedures.
[0402] Vaccine administration. Animals received 1 mg of SARS-CoV-2 DNA
vaccine,
INO-4800, by intradermal injection at day 28 only (1 dose group) or 0 and 28
(2 dose group)
followed by an EP treatment using the CELLECTRA 2000 Adaptive Constant
Current
Electroporation Device with a 3P array (Inovio Pharmaceuticals).
[0403] Serum and heparinised whole blood were collected whilst animals were
sedated at
bi-weekly intervals during the vaccination phase. Nasal and throat swabs were
also collected
on the day of challenge on D56. After challenge, nasal swabs, throat swabs and
serum were
collected at 1, 3, 5 dpc and at cull (6, 7 or 8 dpc ¨ staggered due to the
high level of labor
involved in procedures), with heparinised whole blood collected at 3 dpc and
at cull. Nasal
and throat swabs were obtained as described [Salguero, F.J., et al.,
Comparison of Rhesus and
Cynomolgus macaques as an authentic model for COVID-19. bioRxiv, 2020: p.
2020.09.17.301093.1.
[0404] Clinical observations. Animals were monitored multiple times per day
for
behavioral and clinical changes. Behavior was evaluated for contra-indicators
including
depression, withdrawal from the group, aggression, changes in feeding
patterns, breathing
pattern, respiration rate and cough. Animals were observed and scored as
follows for activity
and health throughout the study. Key: Activity Level: A0 = Active & Alert; Al
= Only active
when stimulated by operator; A2=Inactive even when stimulated/Immobile;
H=Healthy;
S=Sneeze, C=Cough, Nd=Nasal Discharge, Od=Ocular Discharge, Rn=Respiratory
Noises,
- 111 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
Lb=Laboured breathing, L=Lethargy, Di=Diarrhoea, Ax = Loss of Appetite, Dx =
Dehydration, RD=Respiratory Distress. Animal body weight, temperature and
haemoglobin
levels were measured and recorded throughout the study.
[0405] Viruses and Cells
[0406] SARS-CoV-2 Victoria/01/2020 [Caly, L., et al., Isolation and rapid
sharing of the
2019 novel coronavirus (SARS-CoV-2) from the first patient diagnosed with
COVID-19 in
Australia. Med J Aust, 2020. 212(10): p. 459-4621 was generously provided by
The Doherty
Institute, Melbourne, Australia at P1 after primary growth in Vero/hSLAM cells
and
subsequently passaged twice at PHE Porton Down in Vero/hSLAM cells [ECACC
04091501]. Infection of cells was with ¨0.0005 MOI of virus and harvested at
day 4 by
dissociation of the remaining attached cells by gentle rocking with sterile 5
mm borosilicate
beads followed by clarification by centrifugation at 1,000 x g for 10 mins.
Whole genome
sequencing was performed, on the P3 challenge stock, using both Nanopore and
Illumina as
described in Lewandowski, K., et al., Metagenomic Nanopore Sequencing of
Influenza Virus
Direct from Clinical Respiratory Samples. J Clin Microbiol, 2019. 58(1). Virus
titer of the
challenge stocks was determined by plaque assay on Vero/E6 cells [ECACC
850202061. Cell
lines were obtained from the European Collection of Authenticated Cell
Cultures (ECACC)
PHE, Porton Down, UK. Cell cultures were maintained at 37oC in Minimum
essential
medium (MEM) (Life Technologies, California, USA) supplemented with 10% fetal
bovine
serum (FBS) (Sigma, Dorset, UK) and 25 mM HEPES (Life Technologies,
California, USA).
In addition, Vero/hSLAM cultures were supplemented with 0.4 mg/ml of geneticin
(Invitrogen) to maintain the expression plasmid. Challenge substance dilutions
were
conducted in phosphate buffer saline (PBS). Inoculum (5 x 106 PFU) was
delivered by
intratracheal route (2 ml) and intranasal instillation (1.0 ml total, 0.5 ml
per nostril).
[0407] Clinical signs and in-life imaging by computerized tomography
[0408] CT scans were performed two weeks before and five days after challenge
with
SARS-CoV2. CT imaging was performed on sedated animals using a 16 slice
Lightspeed CT
scanner (General Electric Healthcare, Milwaukee, WI, USA) in both the prone
and supine
position and scans evaluated by a medical radiologist expert in respiratory
diseases (as
described previously [Salguero, F.J., et al., Comparison of Rhesus and
Cynomolgus
macaques as an authentic model for COVID-19. 2020: p. 2020.09.17.301093.]). To
provide
the power to discriminate differences between individual NHP's with low
disease volume
- 112 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
(i.e. <25% lung involvement), a refined score system was designed in which
scores were
attributed for possession of abnormal features characteristic of COVID in
human patients
(COVID pattern score) and for the distribution of features through the lung
(Zone score). The
COVID pattern score was calculated as sum of scores assigned for the number of
nodules
identified, and the possession and extent of GGO and consolidation according
to the
following system: Nodule(s): Score 1 for 1, 2 for 2 or 3, 3 for 4 or more;
GGO: each affected
area was attributed with a score according to the following: Score 1 if area
measured < 1 cm,
2 if 1 to 2 cm, 3 if 2 -3 cm, 4 if > 3 cm and scores for each area of GGO were
summed to
provide a total GGO score; Consolidation: each affected area was attributed
with a score
according to the following: 1 if area measured < 1 cm, 2 if 1 to 2 cm, 3 if 2 -
3 cm, 4 if > 3
cm. Scores for each area of consolidation are summed to provide a total
consolidation score.
To account for estimated additional disease impact on the host of
consolidation compared to
GGO, the score system was weighted by doubling the score assigned for
consolidation. To
determine the zone score, the lung was divided into 12 zones and each side of
the lung
divided (from top to bottom) into three zones: the upper zone (above the
carina), the middle
zone (from the carina to the inferior pulmonary vein), and the lower zone
(below the inferior
pulmonary vein). Each zone was further divided into two areas: the anterior
area (the area
before the vertical line of the midpoint of the diaphragm in the sagittal
position) and the
posterior area (the area after the vertical line of the mid-point of the
diaphragm in the sagittal
position). This results in 12 zones in total where a score of one is
attributed to each zone
containing structural changes. The COVID pattern score and the zone are summed
to provide
the Total CT score.
[0409] Post-mortem examination and histopathology. Animals were euthanized at
3
different time-points, in groups of six (including one animal from each
species and sex) at 6,
7 and 8 dpc. The bronchial alveolar lavage fluid (BAL) was collected at
necropsy from the
right lung. The left lung was dissected prior to BAL collection and used for
subsequent
histopathology and virology procedures. At necropsy nasal and throat swabs,
heparinised
whole blood and serum were taken alongside tissue samples for histopathology.
Samples
from the left cranial and left caudal lung lobe together with spleen, kidney,
liver, mediastinal
and axillary lymph nodes, small intestine (duodenum), large intestine (colon),
trachea, larynx
inoculation site and draining lymph node, were fixed by immersion in 10%
neutral-buffered
forrnalin and processed routinely into paraffin wax. Four tirrn sections were
cut and stained
with hematoxylin and eosin (H&E) and examined microscopically. A lung
histopathology
scoring system [Salguero, F.J., et al., Comparison of Rhesus and Cynomolgus
macaques as
- 113 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
an authentic model for COVID-19. bioRxiy, 2020: p. 2020.09.17.3010931 was used
to
evaluate lesions affecting the airways and the parenchyma. Three tissue
sections from each
left lung lobe were used to evaluate the lung histopathology. In addition,
samples were
stained using the RNAscope technique to identify the SARS-CoV-2 virus RNA in
lung tissue
sections. Briefly, tissues were pre-treated with hydrogen peroxide for 10 mins
(RT), target
retrieval for 15 mins (98-102 C) and protease plus for 30 mins (40 C)
(Advanced Cell
Diagnostics). A V-nCoV2019-S probe (SARS-CoV-2 Spike gene specific) was
incubated on
the tissues for two hours at 40 C. In addition, samples were stained using the
RNAscope
technique to identify the SARS-CoV-2 virus RNA. Amplification of the signal
was carried
out following the RNAscope protocol using the RNAscope 2.5 HD Detection kit ¨
Red
(Advanced Cell Diagnostics, Biotechne). All H&E and ISH stained slides were
digitally
scanned using a Panoramic 3D-Histech scanner and viewed using CaseViewer v2.4
software.
The presence of viral RNA by ISH was evaluated using the whole lung tissue
section slides.
Digital image analysis was performed in RNAscope labelled slides to ascertain
the
percentage of stained cells within the lesions, by using the Nikon-NIS-Ar
software package.
104101 Viral load quantification by RT-qPCR. RNA was isolated from nasal swabs
and
throat swabs. Samples were inactivated in AVL (Qiagen) and ethanol. Downstream
extraction was then performed using the BioSprintTm96 One-For-All vet kit
(Indical) and
Kingfisher Flex platform as per manufacturer's instructions. Tissues were
homogenized in
Buffer RLT+ betamercaptoethanol (Qiagen). Tissue homogenate was then
centrifuged
through a QIAshredder homogenizer (Qiagen) and supplemented with ethanol as
per
manufacturer's instructions. Downstream extraction from tissue samples was
then performed
using the BioSprintTm96 One-For-All vet kit (Indical) and Kingfisher Flex
platform as per
manufacturer's instructions.
104111 Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)
targeting a
region of the SARS-CoV-2 nucleocapsid (N) gene was used to determine viral
loads and was
performed using TaqPathTm 1-Step RT-qPCR Master Mix, CG (Applied
BiosystemsTm),
20I9-nCoV CDC RUO Kit (Integrated DNA Technologies) and QuantStudioTM 7 Flex
Real-
Time PCR System. Sequences of the Ni primers and probe were: 2019-nCoV Ni-
forward,
5' GACCCCAAAATCAGCGAAAT 3' (SEQ ID NO: 18) ; 2019-nCoV NI-reverse, 5'
TCTGGTTACTGCCAGTTGAATCTG 3'(SEQ ID NO: 19); 2019-nCoV Nl-probe, 5'
FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3'(SEQ ID NO: 20). The cycling
conditions were: 25 C for 2 minutes, 50 C for 15 minutes, 95 C for 2 minutes,
followed by
- 114 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
45 cycles of 95 C for 3 seconds, 55 C for 30 seconds. The quantification
standard was in
vitro transcribed RNA of the SARS-CoV-2 N ORF (accession number NC 045512.2)
with
quantification between 1 and 6 log copies/pl. Positive swab and fluid samples
detected
below the limit of quantification (LoQ) of 4.11 log copies/ml, were assigned
the value of 5
copies/p.1, this equates to 3.81 log copies/ml, whilst undetected samples were
assigned the
value of < 2.3 copies/pi, equivalent to the assay's lower limit of detection
(LoD) which
equates to 3.47 log copies / ml. Positive tissue samples detected below the
limit of
quantification (LoQ) of 4.76 log copies/ml were assigned the value of 5
copies/1A, this
equates to 4.46 log copies/g, whilst undetected samples were assigned the
value of < 2.3
copies/pi, equivalent to the assay's lower limit of detection (LoD) which
equates to 4.76 log
copies/g.
[0412] Subgenomic RT-qPCR was performed on the QuantStudioTM 7 Flex Real-Time
PCR System using TaqManTm Fast Virus 1-Step Master Mix (Thermo Fisher
Scientific) and
oligonucleotides as specified by WOlfel, et al. Virological assessment of
hospitalized patients
with COVID-2019. Nature 581, 465-469 (2020), with forward primer, probe and
reverse
primer at a final concentration of 250 nM, 125 nM and 500 nM respectively.
Sequences of
the sgE primers and probe were:
2019-nCoV sgE-forward, 5' CGATCTCTTGTAGATCTGTTCTC 3' (SEQ ID NO: 21);
2019-nCoV sgE-reverse, 5' ATATTGCAGCAGTACGCACACA 3' (SEQ ID NO: 22);
2019-nCoV sgE-probe, 5' FAM- ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 3'
(SEQ ID NO: 23).
[0413] Cycling conditions were 50 C for 10 minutes, 95 C for 2 minutes,
followed by 45
cycles of 95 C for 10 seconds and 60 C for 30 seconds. RT-qPCR amplicons were
quantified
against an in vitro transcribed RNA standard of the full length SARS-CoV-2 E
ORF
(accession number NC 045512.2) preceded by the UTR leader sequence and
putative E gene
transcription regulatory sequence described by Wolfel et al 1WOlfel, R.,
Corman, V.M.,
Guggemos, W. et al. Virological assessment of hospitalized patients with COVID-
2019.
Nature 581, 465-469 (2020).1. Positive samples detected below the lower limit
of
quantification (LLOQ) were assigned the value of 5 copies/J.11, whilst
undetected samples
were assigned the value of <0.9 copies/Ill, equivalent to the assays lower
limit of detection
(LLOD). For nasal swab, throat swab and BAL samples extracted samples this
equates to an
LLOQ of 4.11 log copies/mL and LLOD of 3.06 log copies/mL. For tissue samples
this
equates to an LLOQ of 4.76 log copies/g and LLOD of 3.71 log copies/g.
- 115 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
[0414] Plaque reduction neutralization test. Neutralizing virus titers were
measured in heat-
inactivated (56 C for 30 minutes) serum samples. SARS-CoV-2 was diluted to a
concentration of 1.4 x 103 pfu/ml (70 pfu/50 ul) and mixed 50:50 in 1% FCS/MEM
with
doubling serum dilutions from 1:10 to 1:320 in a 96-well V-bottomed plate. The
plate was
incubated at 37 C in a humidified box for one hour to allow the antibody in
the serum
samples to neutralize the virus. The neutralized virus was transferred into
the wells of a
washed plaque assay 24-well plate (see plaque assay method), allowed to adsorb
at 37 C for
a further hour, and overlaid with plaque assay overlay media. After five days
incubation at
37 C in a humified box, the plates were fixed, stained and plaques counted.
[0415] Antigen Binding ELISA. Recombinant SARS-CoV-2 Spike- and RBD-specific
IgG
responses were determined by ELISA. A full-length trimeric and stabilized
version of the
SARS-CoV-2 Spike protein was supplied by Lake Pharma (#46328). Recombinant
SARS-
CoV-2 Receptor-Binding-Domain (319-541) Myc-His was developed and kindly
provided by
MassBiologics. High-binding 96-well plates (Nunc Maxisorp, 442404) were coated
with 50
pi per well of 2 jig/m1 Spike trimer (S1+52) or RBD in lx PBS (Gibco) and
incubated
overnight at 4 C. The ELISA plates were washed and blocked with 5% Fetal
Bovine Serum
(FBS, Sigma, F9665) in lx PBS/0.1% Tween 20 for 1 hour at room temperature.
Serum
collected from animals after vaccination had a starting dilution of 1/50
followed by 8 two-
fold serial dilutions. Post-challenge samples were inactivated in 0.5% triton
and had a starting
dilution of 1/100 followed by 8 three-fold serial dilutions. Serial dilutions
were performed in
10% FBS in lx PBS/0.1% Tween 20. After washing the plates, 50 jil/well of each
serum
dilution was added to the antigen-coated plate in duplicate and incubated for
2 hours at room
temperature. Following washing, anti-monkey IgG conjugated to HRP (Invitrogen,
PA1-
84631) was diluted (1: 10,000) in 10% FBS in 1X PBS/0.1% Tween 20 and 100
ul/well was
added to the plate. Plates were then incubated for 1 hour at room temperature.
After washing,
1 mg/ml 0-Phenylenediamine dihydrochloride solution (Sigma P9187) was prepared
and 100
!al per well were added. The development was stopped with 50 ul per well 1M
Hydrochloric
acid (Fisher Chemical, J/4320/15) and the absorbance at 490 nm was read on a
Molecular
Devices versamax plate reader using Softmax (version 7.0). Titers were
determined using the
endpoint titer determination method. For each sample, an endpoint titer is
defined as the
reciprocal of the highest sample dilution that gives a reading (OD) above the
cut-off The cut-
off was determined for each experimental group as the mean OD + 3SD of naïve
samples.
[0416] Peripheral blood mononuclear cell isolation and resuscitation. PBMCs
were isolated
from whole blood anticoagulated with heparin (132 Units per 8 720 ml blood)
(BD
- 116 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
Biosciences, Oxford, UK) using standard methods. PBMCs isolated from tissues
were stored
at ¨180 C. For resuscitation PBMCs were thawed, washed in R10 medium
(consisting of
RPMI 1640 supplemented with 2 mM L-glutamine, 50 Um' penicillin- 50 p,g/m1
streptomycin, and 10% heat-inactivated FBS) with 1 U/ml of DNase (Sigma), and
resuspended in R10 medium and incubated at 37 C 5% CO2 overnight.
[0417] ELISpot. An IFNy ELISpot assay was used to estimate the frequency and
IFNy
production capacity of SARS-CoV-2-specific T cells in PBMCs using a
human/simian IFNy
kit (MabTech, Nacka. Sweden), as described previously [Sibley, L.S., et al.,
ELISPOT
Refinement Using Spot Morphology for Assessing Host Responses to Tuberculosis.
Cells,
2012. 1(1): p. 5-141 The cells were assayed at 2 x 105 cells per well. Cells
were stimulated
overnight with SARS-CoV-2 peptide pools spanning the ECD spike protein. Five
peptide
pools were 748 used, comprising of 15mer peptides, overlapping by 9 amino
acids. Phorbol
12-myristate (Sigma) (100 ng/ml) and ionomycin (CN Biosciences, 753
Nottingham, UK) (1
mg/ml) were used as a positive control. Results were calculated and reported
as spot forming
units (SFIJ) per million cells. All SARS-CoV-2 peptides were assayed in
duplicate and media
only wells subtracted to give the antigen-specific SFU. EL1SPOT plates were
analyzed using
a CTL scanner and software (CTL, Germany) and further analysis carried out
using
GraphPad Prism (GraphPad Software, USA).
[0418] Statistics. All statistical analyses were performed using GraphPad
Prism 7 or 8
software (La Jolla, CA). These data were considered significant if p <0.05.
The type of
statistical analysis performed is detailed in the figure legend. No samples or
animals were
excluded from the analysis.
[0419] Results:
[0420] Immunogenicity of one and two dose regimens of INO-4800. Twelve (6 male
and 6
female) rhesus macaques were vaccinated with 1 dose (6 animals) or 2 doses (6
animals) of
INO-4800 on day 28 or 0 and 28, respectively (Figure 22A). For each treatment
1 mg INO-
4800 was administered intradermally followed by CELLECTRA-ID EP. A further six
age-
and sex- matched animals were not vaccinated and provided the control group.
Animals were
observed and scored as alert and healthy for the duration of the study, and no
adverse events
or clinical anomalies were recorded in the animals (Figure 23). The serum
titers of SARS-
CoV-2 spike antigen reactive IgG antibodies in all animals were measured
biweekly between
days 0 and 56. In the single dose group (INO-4800 X1) a mean endpoint titer of
467 against
the SARS-CoV-2 spike antigen trimeric Si + S2 ECD form and 442 against the RBD
- 117 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
antigen, and a live virus (Victoria/01/2020 matched to the challenge strain)
neutralization
titer of 239 14 days after vaccination (Figures 22B-D). In the 2 dose group
(INO-4800 X2) a
mean endpoint titer of 2,142 against the Si + S2 ECD and 1,538 against the RBD
antigen,
and a live virus neutralization titer of 2,199 was measured 14 days after the
2nd vaccination
(Figures 22B-D). Vaccination with INO-4800 induced SARS-CoV-2 spike antigen-
specific
Thl T cell responses in the PBMC population as measured by an IFN-7 ELISpot
(Figure
22E). In summary, intradermal delivery of INO-4800 induced a functional
humoral and T
cell response against SARS-CoV-2 spike protein which was boosted after a
second dose. At
the day of viral challenge (Day 56) the level of SARS-CoV-2 neutralizing
antibodies in the
serum was significantly higher in the vaccinated groups compared to the
control group (p =
0.015). Following viral challenge there was a slight increase in SARS-CoV-2
spike binding
and neutralizing antibody titers in all the groups between days 56 and 62-64
(Figures 22B-
D). In the control group there was an increase in the cellular immune response
to peptides
spanning the SARS-CoV-2 spike antigen after viral challenge, but little change
in the
vaccinated groups, likely due to control of viral infection by the humoral arm
of the host
immune system (Figure 22F).
[0421] Viral loads in the upper and lower respiratory tracts after SARS-CoV-2
challenge
[0422] On day 56 all animals were challenged with a total of 5x10'6 pfu SARS-
CoV-2
delivered to both the upper and lower respiratory tract. No overt clinical
symptoms were
observed throughout the duration (6-8 days) of the challenge in any of the
animals (Figures
23A-23C). At indicated timepoints nasal and throat swabs were collected from
the animals.
SARS-CoV-2 viral genomic (viral RNA) and subgenomic (sgmRNA), which represents
replicating virus were measured by RT-qPCR (Figures 24A and 25A). Analysis of
viral
RNA area under the curve (AUC) levels in the throat revealed significantly
reduced levels in
the vaccinated groups (Figure 24B). Additionally, the peak viral load level
measured in the
INO-4800 X2 group was significantly reduced compared to the control group
(Figure 24C).
Analysis revealed a significant negative correlation between throat viral
loads and
neutralizing and anti-RBD IgG titers (Figures 15A-15D). SARS-CoV-2 sgmRNA data
revealed a similar trend to reduction of viral load in the vaccinated groups
compared to
controls (Figures 25A-C). Analysis in the nasal compartment revealed a trend
for reduction
and accelerated clearance of viral RNA and sgmRNA in the vaccinated groups
compared to
control, but did not reach a level of significance (Figures 24D-F and 25D-F).
Analysis
- 118 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
revealed a significant negative correlation between nasal viral loads and
neutralizing and anti-
RBD IgG titers on day 3, but not day 1 (Figures 15E-15H).
[0423] At the time of necropsy (6-8 days post challenge), BAL fluid was
collected from
each animal. Measurement of the levels of SARS-CoV-2 viral RNA and sgmRNA
revealed a
reduction of the average virus in vaccinated groups, even though the levels
were variable
within each group dependent on the day of necropsy (Figures 26A, 26B). RT-qPCR
was also
performed on tissues collected at necropsy. At these timepoints post challenge
the SARS-
CoV-2 viral RNA levels detected were below limit of quantification in most
tissues except
the lungs (Figure 27). Measurements of the level of SARS-CoV-2 viral mRNA and
sgmRNA
detected in the lung tissue samples indicated reduced average viral load in
the vaccinated
animals (Figures 26C and 26D).
[0424] In summary data showed a significant reduction of viral load in the
throat, and a
trend for a reduction of viral loads in the lungs of the vaccinated groups.
The collection of
BAL and lung tissue samples at different timepoints (days 6, 7 or 8) after
challenge likely
added to the intragroup variability observed impacting statistical analysis.
RT-qPCR viral
load data indicate INO-4800 vaccination has a positive effect in reducing
viral loads in rhesus
macaques challenged with high dose SARS-CoV-2, in general, lower viral levels
were
measured in the 2 dose vaccine group compared to one dose vaccine group.
[0425] Disease burden in the lungs after SARS-CoV-2 challenge.
[0426] The pulmonary disease burden was assessed on harvested lung tissues
collected at
necropsy 6 to 8 days after challenge. Analysis was performed on all animals in
the study in a
double blinded manner. Histopathological analysis of lung tissue was performed
on multiple
organ tissues, but only the lungs showed remarkable lesions, compatible with
SARS-CoV-2
infection. Pulmonary lesions consistent with infection with SARS-CoV-2 were
observed in
the lungs of animals from the unvaccinated control and at a reduced level in
vaccinated
groups. Representative histopathology images are provided in Figure 28.
Briefly, the lung
parenchyma was comprised of multifocal to coalescing areas of pneumonia
surrounded by
unaffected parenchyma. Alveolar damage, with necrosis of pneumocytes was a
prominent
feature in the affected areas. Alveolar spaces and interalveolar septa
contained mixed
inflammatory cells (including macrophages, lymphocytes, viable and degenerated
neutrophils, and occasional eosinophils), and edema. Type II pneumocyte
hyperplasia was
also observed in distal bronchioles and bronchiolo-alveolar junctions. In the
larger airways
occasional, focal, epithelial degeneration and sloughing was observed in the
respiratory
- 119 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
epithelium. Low numbers of mixed inflammatory cells, comprising neutrophils,
lymphoid
cells, and occasional eosinophils, infiltrated bronchial and bronchiolar
walls. In the lumen of
some airways, mucus admixed with degenerative cells, mainly neutrophils and
epithelial
cells, was seen. Within the parenchyma, perivascular and peribronchiolar
cuffing was also
observed, being mostly lymphoid cells comprising the infiltrates.
[0427] The histopathology score and percent tissue area of SARS-CoV-2 RNA
positivity
were applied to quantify the disease burden. The unvaccinated group showed the
highest
histopathological scores in the lung when compared with the vaccinated groups
(Figures 29A
and 29C). Animals from vaccinated groups showed reduced pathology when
compared with
unvaccinated animals, except for animal #10A from INO-4800X1 group, which
showed
histopathological scores similar to the unvaccinated animals. To detect the
presence of
SARS-CoV-2 RNA in the lung tissue, in situ hybridization (ISH) was performed.
Viral RNA
was observed in pneumocytes and inflammatory cells within the
histopathological lesions
with reduced frequency in the vaccinated animals (Figure 29B).
[0428] CT scans were performed to provide an in-life, unbiased, and
quantifiable metric of
lung disease. Results from lung CT imaging performed 5 days after challenge
with SARS-
CoV-2 were evaluated for the presence of COVID-19 disease features: ground
glass opacity
(GGO), consolidation, crazy paving, nodules, pen-lobular consolidation;
distribution - upper,
middle, lower, central 2/3, peripheral, bronchocentric, and for pulmonary
embolus. The
medical radiologist was blinded to the animal's treatment and clinical status.
The extent of
lung involvement was evaluated and quantified using a scoring system developed
for COVID
disease. The score system parameters are provided in materials and methods
section.
Pulmonary abnormalities characteristic of COVID-19 disease where observed in 3
out of 6
and 2 out of 6 animals in the INO-4800 one dose or two dose groups,
respectively, and in 5
out of 6 unvaccinated animals in the control group (representative CT scan
images are
provided in Figure 30). The extent of lung involvement in the animals with
disease
involvement was less than 25% and considered low level disease (Figure 290).
There was a
trend for disease scores to be highest in the unvaccinated control group with
a reduction in
the INO-4800 one and two dose groups (Figures 29E-29C). The comparison of
scores
between groups did not reach statistical difference (p = 0.0584 between INO-
4800 two dose
group and no vaccine group, Mann Whitney test). One outlier animal (10A) in
the INO-4800
X1 group scored higher than other animals. However, the level of disease was
still considered
low and comparable disease burden had been observed in other NHP SARS-CoV-2
challenge
studies performed under the same conditions. In summary, CT scanning provides
a useful
- 120 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
measure of SARS-CoV-2-induced disease in rhesus macaques. Day 5 post SARS-CoV-
2
infection, abnormalities where present were reported at low levels (<25% of
lung involved).
Evidence from CT scans suggested trends for differences in pulmonary disease
burden
between groups, with disease burden highest in the nonvaccinated control
group.
[0429] In summary, after high dose SARS-CoV-2 challenge of nonhuman primates
the
disease burden was reduced in the animals receiving a single of two dose
regimen of INO-
4800 vaccine. There was no indication of vaccine enhanced disease, even in
animals
receiving a suboptimal one dose vaccination regimen.
[0430] Discussion
[0431] This example describes the safety, immunogenicity, and efficacy
assessments of the
SARS-CoV-2 DNA vaccine INO-4800 in a stringent high dose nonhuman primate
challenge
model. Intradermal delivery of 1 mg of INO-4800 to rhesus macaques induces
both humoral
and T cell responses against the SARS-CoV-2 spike antigen in both a 2-dose
regimen and a 1
dose regimen. Throughout the study no overt clinical events were recorded in
the animals.
After a high dose SARS-CoV-2 challenge, a reduction in viral loads was
observed and lung
disease burden in both the 1 and 2 dose vaccine groups supporting the efficacy
of INO-4800.
Importantly, vaccine enhanced disease (VED) was not observed, even with the 1
dose group.
[0432] The rhesus macaque model has become a widely employed model for
assessing
medical countermeasures against SARS-CoV-2. Importantly, wildtype non-adapted
SARS-
CoV-2 replicates in the respiratory tract of rhesus macaques, and the animal
presents with
some of the characteristics observed in humans with mild COVID-19 symptoms
[Salguero.
F.J., et al., Comparison of Rhesus and Cynomolgus macaques as an authentic
model for
COVID-19. 2020: p. 2020.09.17.301093.; Mufloz-Fontela, C., etal., Animal
models for
COVID-19. Nature, 2020. 586(7830): p. 509-5151. Here, focus was placed on the
lung
disease burden in SARS-CoV-2 challenged rhesus macaques which had been
vaccinated with
INO-4800. While the level of lung disease burden measured in the animals was
mild, a
significant reduction in of histopathology and viral detection scores in the
lungs of vaccinated
animals was observed (Figure 29). This suggests the potential for a positive
impact on the
LRT disease which is observed in COVID-19 patients which progress to severe
disease.
Interestingly, a significant reduction in viral loads in the throat
compartment in the upper
respiratory tract was also observed, but only a trend for reduction in the
nasal compartment. It
may be that differential induction of mucosal immunity exists between the
throat and nasal
compartment. Interestingly, a significant negative correlation between the RBD
targeting and
- 121 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
neutralizing antibodies in the serum with throat, but not nasal, viral loads
was observed at day
1 post challenge (Figure 15). However, the levels of these antibodies in
either of these URT
compartments were not assayed to provide further evidence of the presence of
increased
levels of functional antibodies in the throat compared to nasal passage.
Another possibility
could be that viral control in the nasal compartment where the extensive
(5x106 pfu) SARS-
CoV-2 challenge dose was directly instilled may be a higher bar than in other
mucosal
compartments. In support of this, data in the control animals showed nasal
swabs yielded
higher viral titers than throat swabs, with similar observations being
reported in COVID-19
subjects [Mohammadi, A., et al., SARS-CoV-2 detection in different respiratory
sites: A
systematic review and meta-analysis. EBioMedicine, 2020. 59: p. 102903.1
[0433] Importantly, the data indicated that enhanced respiratory disease (ERD)
was not
associated with INO-4800 immunization in either the 1 dose or 2 dose regimen.
In the INO-
4800 X1 dose group, one animal (10A) did present with the highest lung
histopathology score
and CT scan score. However, the multifocal lesions in animal 10A showed a
similar
histopathological pattern as those observed in the animals from the
nonvaccinated group,
with no apparent influx of different inflammatory cell subpopulations in the
infiltrates. A
potential hallmark of vaccine enhanced disease is the increased influx of
inflammatory cells
such as eosinophils [Bolles, M., et al., A double-inactivated severe acute
respiratory
syndrome coronavirus vaccine provides incomplete protection in mice and
induces increased
eosinophilic proinflammatory pulmonary response upon challenge. J Virol, 2011.
85(23): p.
12201-15; Yasui, F., et al., Prior Immunization with Severe Acute Respiratory
Syndrome
(SARS)-Associated Coronavirus (SARS-CoV) Nucleocapsid Protein Causes Severe
Pneumonia in Mice Infected with SARS-CoV. The Journal of Immunology, 2008.
181(9): p.
6337-6348.1. The CT scan and histopathology data for animal 10A are believed
not to be
associated with ERD, but rather a disease score and pattern similar to that of
nonvaccinated
animals. Similar lung histopathology inflammation scores ranging from minimal-
mild to
mild-moderate were reported in samples analyzed 7 or 8 days after challenge in
rhesus
macaques receiving other vaccine candidates [Corbett, K.S., et al., Evaluation
of the mRNA-
1273 Vaccine against SARS-CoV-2 in Nonhuman Primates. New England Journal of
Medicine, 2020. 383(16): p. 1544-15551. Currently, VED remains a theoretical
concern with
SARS-CoV-2 vaccination and attempts to induce enhanced disease using a
formalin
inactivated whole virus preparation of SARS-CoV-2 have failed to repeat the
lung pathology
previously reported for other inactivated respiratory viral vaccines [Bewley,
KR., et al.,
Immunological and pathological outcomes of SARS-CoV-2 challenge after formalin-
- 122 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
inactivated vaccine immunization of ferrets and rhesus macaques. 2020: p.
2020.12.21.4237461.
[0434] This data compliments the NHP SARS-CoV-2 challenge study which
demonstrated
reduction in LRT viral loads several months after INO-4800 immunization
(Example 9).
However, there are distinct differences between the studies, including
different doses and
variants used for the challenge stock, and the timing of the challenge. In the
study described
in this example, the animal was challenged four weeks after the last
vaccination, at a
timepoint when high levels of circulating neutralizing antibodies were
present. In the other
study, the level of serum SARS-CoV-2 neutralizing antibody was low at the time
of
challenge, protection appeared to be dependent on the recall of a memory
response, with a
strong humoral and cellular response against SARS-CoV-2 spike antigen detected
in the
animals. Here, an anamnestic response of a similar magnitude was not observed,
suggesting
protection may have been mediated by the antibodies present in circulation at
time of
challenge which is supported by the correlation between serum SARS-CoV-2
targeting
antibody levels and reductions in viral loads (Figure 15).
[0435] In conclusion, the results here in a stringent preclinical SARS-CoV-2
animal model
provide further support for the efficacy and safety of the DNA vaccine INO-
4800 as a
prophylactic countermeasure against COVID-19. Importantly, tested as a single
dose
immunization we observed a positive impact on the lung disease burden and no
VED. Taken
together with INO-4800 clinical data. INO-4800 has many attributes in terms of
safety,
efficacy and logistical feasibility due its high stability, negating the need
for challenging cold
chain distribution requirements for global access. Furthermore, synthetic DNA
vaccine
technology is amenable to highly accelerated developmental timelines,
permitting rapid
design and testing of candidates against new SARS-CoV-2 variants which display
potential
for immune escape [Wibmer, C.K., et al., SARS-CoV-2 501Y.V2 escapes
neutralization by
South African COVID-19 donor plasma. 2021: p. 2021.01.18.427166.; Moore, J.P.
and P.A.
Offit, SARS-CoV-2 Vaccines and the Growing Threat of Viral Variants. JAMA,
2021.1
[0436] EXAMPLE 9 SARS-COV-2 DNA vaccine induces humoral and cellular
immunity resulting in memory responses which provide anamnestic protection in
a
rhesus macaque challenge
[0437] The immunogenicity of a synthetic DNA vaccine encoding the SARS-CoV-2
Spike
protein was previously demonstrated in both mice and guinea pigs (Example 1).
In this
example, the durability of INO-4800-induced immune responses in rhesus
macaques is
- 123 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
demonstrated. ID-EP administration in rhesus macaques induced cellular and
humoral
responses to SARS-Cov-2 S protein, with additional cross reactivity to the
SARS-CoV-1 S
protein. Protective efficacy is demonstrated more than 3 months post-final
immunization,
demonstrating establishment of amamnestic immune responses and reduced viral
loads in
vaccinated macaques. After viral challenge, a reduction in subgenomic
messenger RNA
(sgmRNA) BAL viral loads was observed compared to control animals with 1 mg
(1/5th the
DNA dose) administered via intradermal (ID) delivery. This was associated with
induction
of a rapid recall response in both cellular and humoral immune arms,
supporting the potential
for the INO-4800 candidate to moderate disease. No adverse events or evidence
of vaccine
enhanced disease (VED) were observed in animals in the vaccine group. Reduced
viral
subgenomic RNA loads in the lower lung and lower VL were observed. In the
nose, a trend
of lower VL was observed. These data support that immunization with this DNA
vaccine
candidate limits active viral replication and has the potential to reduce
severity of disease, as
well as reduced viral shedding in the nasal cavity.
[0438] It is important to note that the initial viral loads detected in
control animals in this
study were on average 1-2 logs higher (109 PFU/swab in 4/5 NHPs on day 1 post-
challenge)
than in similar published studies performed under identical conditions (-107
PFU/swab) (Yu
et al., 2020, Science, eabc6284). Only two of the prior reported NHP studies
included
intranasal delivery as inoculation route for challenge (van Doremalen et al.,
2020, bioRxiv
2020.05.13.093195; Yu et al., 2020, Science, eabc6284). High-dose challenge
inoculums are
frequently employed to ensure take of infection, however non-lethal systems
such as this
SARS-CoV-2 rhesus macaque model may artificially reduce the impact of
potentially
protective vaccines and interventions (Durudas et al., 2011, Curr HIV Res 9,
276-288; Innis
et al., 2019, Vaccine 37, 4830-4834). Despite these limitations, this study
demonstrated
significant reduction in peak BAL sgmRNA and overall viral RNA, likely induced
by rapid
induction of immunological memory mediated by both B and T cell compartments.
Wolfel et
al reported nasal titers in patients average 6.5 x 105 copies/swab days 1-5
following onset of
symptoms (Wolfel et al., 2020, Nature 581, 465-469). These titers are
significantly lower
than the challenge dose and support potential for the vaccine candidate to
control early during
SARS-CoV-2 infection.
104391 This study shows that DNA vaccination with a vaccine candidate
targeting the full-
length SARS-CoV-2 spike protein likely increases the availability T cell
immunodominant
epitopes leading to a broader and more potent immune response, compared to
partial domains
- 124 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
and truncated immunogens. In this study, T cell cross-reactivity was observed
to SARS-
CoV-1.
[0440] In addition to T cells, INO-4800 induced durable antibody responses
that rapidly
increased following SARS-CoV-2 challenge. It is further demonstrated that INO-
4800
induced robust neutralizing antibody responses against both D614 and G614 SARS-
CoV-2
variants. While the DIG 614 site is outside the RBD, it has been suggested
that this shift has
the potential to impact vaccine-elicited antibodies (Korber B et al., 2020,
Cell 182:1-16).
Other studies report that the G614 variant exhibits increased SARS-CoV-2
infectivity (Hu et
al., 2020, bioRxiv 2020.06.20.161323; Ozono S, 2020, bioRxiv
2020.06.15.151779). The
data shows induction of comparable neutralization titers between D614 and G614
variants
and that these responses are similarly recalled following SARS-CoV-2
challenge.
104411 Materials & Methods
[0442] Non-human primate Immunizations, IFNy ELISpot and ELISA
[0443] DATA vaccine, INO-4800: The highly optimized DNA sequence encoding SARS-
CoV-2 IgE-spike was created using lnovio's proprietary in silico Gene
Optimization
Algorithm to enhance expression and immunogenicity (Smith et al., 2020, Nat
Commun //,
2601). The optimized DNA sequence was synthesized, digested with BamHI and
XhoI, and
cloned into the expression vector pGX0001 under the control of the human
cytomegalovirus
immediate-early promoter and a bovine growth hormone polyadenylation signal.
[0444] Animals: All rhesus macaque experiments were approved by the
Institutional
Animal Care and Use Committee at Bioqual (Rockville, Maryland), an Association
for
Assessment and Accreditation of Laboratory Animal Care (AAALAC) International
accredited facility. Blood was collected for blood chemistry, PBMC isolation,
serological
analysis. BAL was collected on Week 8 to assay lung antibody levels and on
Days 1, 2, 4, 7
post challenge to assay lung viral loads.
[0445] Immunizations, sample collection and viral challenge. Ten Chinese
rhesus macaques
(ranging from 4.55kg-5.55kg) were randomly assigned in study immunized (3
males and 2
females) or naive (2 males and 3 females). Immunized macaques received two 1
mg
injections of SARS-CoV-2 DNA vaccine, INO-4800 at week 0 and 4 by ID-EP
administration using the CELLECTRA 20000 Adaptive Constant Current
Electroporation
Device with a 3P array (Inovio Pharmaceuticals). Blood was collected at
indicated time
points to analyse blood chemistry, peripheral blood mononuclear cells (PBMC)
isolation, and
serum was collected for serological analysis. Bronchoalveolar lavage was
collected at Week
- 125 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
8 to assay lung antibody levels. BAL from naïve animals was run as control. At
week 17, all
animals were challenged with 1.2x108 VP (1.1x104PFU) SARS-CoV-2. Virus was
administered as 1 ml by the intranasal (IN) route (0.5 ml in each nostril) and
1 ml by the
intratracheal (IT) route.
[0446] Peripheral blood mononuclear cell isolation. Blood was collected from
each
macaque into sodium citrate cell preparation tubes (CPT, BD Biosciences). The
tubes were
centrifuged to separate plasma and lymphocytes, according to the
manufacturer's protocol.
Samples were transported by same-day shipment on cold-packs from Bioqual to
The Wistar
Institute for PBMC isolation. PBMCs were washed and residual red blood cells
were
removed using ammonium-chloride-potassium (ACK) lysis buffer. Cells were
counted using
a ViCell counter (Beckman Coulter) and resuspended in RPMI 1640 (Coming),
supplemented with 10% fetal bovine serum (Atlas), and 1%
penicillin/streptomycin (Gibco).
Fresh cells were then plated for IFNy ELISpot Assays and flow cytometry.
[0447] 1FN-y Enzyme-linked immunospot (EL1Spot). Monkey interferon gamma (1FN-
y)
ELISpot assay was performed to detect cellular responses. Monkey IFN-y
ELISpotPro
(alkaline phosphatase) plates (Mabtech, Sweeden, Cat#3421M-2APW-10) were
blocked for a
minimum of 2 hours with RPMI 1640 (Corning), supplemented with 10% FBS and 1%
penn/strep (R10). Following PBMC isolation, 200 000 cells from macaques were
added to
each well in the presence of 1) overlapping peptide pools (15-mers with 9-mer
overlaps)
corresponding to the SARS-CoV-1, SARS-CoV-2, or MERS-CoV Spike proteins
(5 g/mL/well final concentration), 2) R10 with DMSO (negative control), or 3)
anti-CD3
positive control (Mabtech, 1:1000 dilution). All samples were plated in
triplicate. Plates
were incubated overnight at 37 C, 5% CO2. After 18-20 hours, the plates were
washed in
PBS and spots were developed according to the manufacturer's protocol. Spots
were imaged
using a CTL Immunospot plate reader and antigen-specific responses were
determined by
subtracting the number of spots in the R1O+DMS0 negative control well from the
wells
stimulated with peptide pools.
[0448] Antigen Binding ELISA. Serum and BAL was collected at each time point
was
evaluated for binding titers as indicated. Ninety-six well immunosorbent
plates (NUNC)
were coated with lug/mL recombinant SARS-CoV-2 S1+S2 ECD protein (Sino
Biological
40589-V08B1), Si protein (Sino Biological 40591-VO8H), S2 protein (Sino
Biological
40590-VO8B), or receptor-binding domain (RBD) protein (Sino Biological 40595-
VO5H) in
DPBS overnight at 4 C. ELISA plates were also coated with lug/mL recombinant
SARS-
CoV Si protein (Sino Biological 40150-VO8B1) and RBD protein (Sino Biological
40592-
- 126 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
VO8B) or MERS-CoV Spike (Sino Biological 40069-VO8B). Plates were washed four
times
with PBS + 0.05% Tween20 (PBS-T) and blocked with 5% skim milk in PBS-T (5%
SM) for
90 minutes at 37 C. Sera or BAL from INO-4800 vaccinated macaques were
serially diluted
in 5% SM, added to the washed ELISA plates, and incubated for 1 hour at 37 C.
Following
incubation, plates were washed 4 times with PBS-T and an anti-monkey IgG
conjugated to
horseradish peroxidase (Southern Biotech 4700-5). Plates were washed 4 times
with PBS-T
and one-step TMB solution (Sigma) was added to the plates. The reaction was
stopped with
an equal volume of 2N sulfuric acid. Plates were read at 450nm and 570nm
within 30
minutes of development using a Biotek Synergy2 plate reader.
[0449] ACE2 Competition ELISA-Non-human primates. 96-well half area plates
(Corning)
were coated at room temperature for 3 hours with 1 tig/mL PolyRab anti-His
antibody
(ThermoFisher, PA1-983B), followed by overnight blocking with blocking buffer
containing
lx PBS, 5% skim milk, 1% FBS, and 0.2% Tween-20. The plates were then
incubated with
mg/mL of His6x-tagged SARS-CoV-2 ("His6x" disclosed as SEQ ID NO: 25), S1+S2
ECD (Sinobiological, 40589-VO8B1) at room temperature for 1-2 hours. NHP sera
(Day 0 or
Week 6) was serially diluted 3-fold with 1XPBS containing 1% FBS and 0.2%
Tween and
pre-mixed with huACE2-IgMu at constant concentration of 0.4ug/ml. The pre-
mixture was
then added to the plate and incubated at RT for 1-2 hours. The plates were
further incubated
at room temperature for 1 hour with goat anti-mouse IgG H+L HRP (A90-116P,
Bethyl
Laboratories) at 1:20.000 dilution followed by addition of one-step TMB ultra
substrate
(ThermoFisher) and then quenched with 1M H2SO4. Absorbance at 450nm and 570nm
were
recorded with BioTEK plate reader.
[0450] Flow cytometry-based ACE2 receptor binding inhibition assay. HEK-293T
cells
stably expressing ACE2-GFP were generated using retroviral transduction.
Following
transduction, the cells were flow sorted based on GFP expression to isolate
GFP positive
cells. Single cell cloning was done on these cells to generate cell lines with
equivalent
expression of ACE2-GFP. To detect inhibition of Spike binding to ACE2, S1+S2
ECD-his
tagged (Sino Biological, Catalog #40589-VO8B1) was incubated with serum
collected from
vaccinated animals at indicated time points and dilutions at concentration of
2.5 u.g/m1 on ice
for 60 minutes. This mixture was then transferred to 150,000 293T-ACE2-GFP
cells and
incubated on ice for 90 minutes. Following this, the cells were washed 2x with
PBS followed
by staining for surelight APC conjugated anti-his antibody (Abcam, ab72579)
for 30 min
on ice. As a positive control, Spike protein was pre-incubated with
recombinant human
- 127 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
ACE2 before transferring to 293T-Ace2-GFP cells. Data was acquired using a BD
LSRII and
analyzed by FlowJo (version 10).
[0451] Pseudovirus Neutralization Assay. SARS-CoV-2 pseudovirus were produced
using
HEK293T cells transfected with GeneJammer (Agilent) using IgE-SARS-CoV-2 S
plasmid
(Genscript) and pNL4-3.Luc.R-E- plasmid (NIH AIDS reagent) at a 1:1 ratio.
Forty-eight
hours post transfection, transfection supernatant was collected, enriched with
FBS to 12%
final volume, steri-filtered (Millipore Sigma), and aliquoted for storage at -
80 C. SARS-Cov-
2 pseudovirus neutralization assay was set up using D10 media (DMEM
supplemented with
10%FBS and lx Penicillin-Streptomycin) in a 96 well format. CHO cells stably
expressing
Ace2 were used as target cells (Creative Biolabs, Catalog No. VCeL-Wyb019).
SARS-Cov-2
pseudovirus were titered to yield greater than 20 times the cells only control
relative
luminescence units (RLU) after 72h of infection. For setting up neutralization
assay, 10,000
CHO-ACE2 cells were plated in 96-well plates in 100u1 D10 media and rested
overnight at
37 C and 5% CO2 for 24 hours. Following day, Monkey and Rabbit sera from INO-
4800
vaccinated and control groups were heat inactivated and serially diluted as
desired. Sera were
incubated with a fixed amount of SARS-Cov-2 pseudovirus for 90 minutes at RT.
50u1 media
was removed from the plated CHO-Ace2 cell containing wells. Post 90 minutes,
the mix was
added to plated CHO-Ace2 cells and allowed to incubate in a standard incubator
(37%
humidity, 5% CO2) for 72h. Post 72h, cells were lysed using britelite plus
luminescence
reporter gene assay system (Perkin Elmer Catalog no. 6066769) and RLU were
measured
using the Biotek plate reader. Neutralization titers (ID50) were calculated
using GraphPad
Prism 8 and defined as the reciprocal serum dilution at which RLU were reduced
by 50%
compared to RLU in virus control wells after subtraction of background RLU in
cell control
wells.
[0452] Viral RNA assay. RT-PCR assays were utilized to monitor viral loads,
essentially as
previously described (Abnink P et al 2019 Science). Briefly, RNA was extracted
using a
QIAcube HT (Qiagen,Germany) and the Cador pathogen HT kit from bronchoalveolar
lavage
(BAL) supernatant and nasal swabs. RNA was reverse transcribed using
superscript VILO
(Invitrogen) and ran in duplicate using the QuantStudio 6 and 7 Flex Real-Time
PCR System
(Applied Biosystems) according to manufacturer's specifications. Viral loads
were calculated
of viral RNA copies per mL or per swab and the assay sensitivity was 50
copies. The target
for amplification was the SARS-CoV2 N (nucleocapsid) gene. The primers and
probes for the
targets were: 2019-nCoV Nl-F :5'-GACCCCAAAATCAGCGAAAT-3' (SEQ ID NO:18);
- 128 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
2019-nCoV Nl-R: 5'-TCTGGTTACTGCCAGTTGAATCTG-3' (SEQ ID NO:19); 2019-
nCoV NI -P: 5'-FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1-3' (SEQ ID NO:20).
[0453] Subgenomic mRNA assay. SARS-CoV-2 E gene subgenomic mRNA (sgmRNA)
was assessed by RT-PCR using an approach similar to previously described
(Wolfel R et al.
2020, Nature, 581, 465-469). To generate a standard curve, the SARS-CoV-2 E
gene
sgmRNA was cloned into a pcDNA3.1 expression plasmid; this insert was
transcribed using
an AmpliCap-Max T7 High Yield Message Maker Kit (Cellscript) to obtain RNA for
standards. Prior to RT-PCR, samples collected from challenged animals or
standards were
reverse-transcribed using Superscript III VILO (Invitrogen) according to the
manufacturer's
instructions. A Taqman custom gene expression assay (ThermoFisher Scientific)
was
designed using the sequences targeting the E gene sgmRNA (18). Reactions were
carried out
on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems)
according to
the manufacturer's specifications. Standard curves were used to calculate
sgmRNA in copies
per ml or per swab; the quantitative assay sensitivity was 50 copies per ml or
per swab.
[0454] Results
[0455] Induction of memory humoral and cellular immune responses in INO-4800
immunized non-human primates. Non-human primates (NHP) are a valuable model in
the
development of COVID-19 vaccines and therapeutics as they can be infected with
wild-type
SARS-CoV-2, and present with similar pathology to humans (Chandrashekar et
al., 2020,
Science, eabc4776; Qin et al., 2005, J Pathol 206, 251-259; Yao et al., 2014,
J Infect Dis 209,
236-242; Yu et al., 2020, Science, eabc6284). Rhesus macaques (n=5) received
two
immunizations of INO-4800 (1mg), at Week 0 and Week 4 (Figure 33A). Naive
control
animals (n=5) did not receive vaccine. Humoral and cellular immune responses
were
monitored for 15 weeks (-4 months) following prime immunization for memory
responses.
All animals seroconverted following a single INO-4800 immunization, with serum
IgG titers
detected against the full-length S1+S2 extracellular domain (ECD), Si, S2, and
RBD regions
of the SARS-CoV-2 S protein (Figure 33B and Figure 33C). Cross-reactive
antibodies
were also detected against SARS-CoV Si protein and RBD, but not MERS-CoV
(Figure 34).
SARS-CoV-2-reactive IgG against the ECD and RBD were detected in
bronchoalveolar
lavage (BAL) washes at Week 8 following immunization (Figure 34).
[0456] In serum samples of the animals SARS-CoV-2 pseudovirus neutralization
activity
was detected for >4 months following immunization (Figure 33D), demonstrating
memory
titers comparable to those observed in other reported acute protection studies
in macaques
- 129 -
CA 03168353 2022- 8- 17

WO 2021/173829
PCT/US2021/019662
(Gao et al., 2020, Science 369, 77-81; Tian et al., 2020, Emerg Microbes
Infect, 9:382-385;
van Doremalen et al., 2020, bioRxiv 2020.05.13.093195; Yu et al., 2020,
Science, eabc6284)
and reported for convalescent humans (Ni et al., 2020, Immunity 52, 971-977
e973; Robbiani
et al., 2020, Nature, s41586-020-2456-9). During the course of the COVID-19
pandemic, a
D614G SARS-CoV-2 spike variant has emerged that has potentially greater
infectivity, and
now accounts for >80% of new isolates (Korber B et al., 2020, Cell 182:1-16).
There is
concern that vaccines developed prior to this variant's appearance may not
neutralize the
D614G virus. Therefore, neutralization against this new variant was evaluated
using a
modified pseudovirus expressing the G614 Spike protein (Figure 33E). Similar
neutralization ID50 titers were observed against both D614 and G614 spikes,
supporting
induction of functional antibody responses by INO-4800 against the now
dominating SARS-
CoV-2 variant.
[0457] To further investigate the neutralizing activities, the sera was also
tested using an
ACE2 competition EL1SA, where sera from 80% of immunized NHPs inhibited the
SARS-
CoV-2 Spike-ACE2 interaction (Figure 33F). 100% of macaques responded in the
flow
cytometry ACE2-293T inhibition assay, with 53-96% inhibition of the Spike-ACE2
interaction at a 1:10 dilution and 24-53% inhibition at a 1:30 dilution
(Figure 33G).
[0458] INO-4800 immunization also induced SARS-CoV-2 S antigen reactive T cell
responses against all 5 peptide pools with T cells responses peaking at Week
6, two weeks
following the second immunization (0-518 SFU/million cells) (Figure 33H).
Distinct
immunogenic epitope responses were detected against the RBD and S2 regions
(Figure 33B).
Cross-reactive T cells responses were also detected against the SARS-CoV Spike
protein
(Figure 36A). However, cross-reactivity was not observed to MERS-CoV Spike
peptides,
which supports the lower sequence homology between SARS-CoV-2 and MERS-CoV
(Figure 36B).
[0459] Vaccine induced memory recall responses upon SARS-CoV-2 challenge in
non-
human primates. Vaccine immunized macaques along with unvaccinated controls
were
challenged with SARS-CoV-2 13 weeks (-3 months) post-final immunization (Study
Week
17, Figure 37A). NHPs received a challenge dose of 1.1x104 PFU of SARS-CoV-2
Isolate
USA-WA1/2020 by intranasal and intratracheal inoculation as previously
described
(Chandrashekar et al., 2020; Yu et al., 2020). Upon viral challenge, 3/5 of
INO-4800
vaccinated animals had an immediate increase in antibody titers against the
SARS-CoV-2
full-length ECD. By day 7, 5/5 animals had an increase in antibody titers
against both full
length ECD and RBD (Figure 37B). Seven days post-challenge, robust geometric
mean
- 130 -
CA 03168353 2022- 8- 17